Transcript: Mouse NM_001166413.1

Mus musculus Rho guanine nucleotide exchange factor (GEF) 25 (Arhgef25), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Arhgef25 (52666)
Length:
2199
CDS:
55..1884

Additional Resources:

NCBI RefSeq record:
NM_001166413.1
NBCI Gene record:
Arhgef25 (52666)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001166413.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340839 GTGGTGTACTGCCAGAATAAA pLKO_005 892 CDS 100% 15.000 21.000 N Arhgef25 n/a
2 TRCN0000120372 GCATGATTCCTCAATGAATTT pLKO.1 1913 3UTR 100% 13.200 18.480 N Arhgef25 n/a
3 TRCN0000340771 GCATGATTCCTCAATGAATTT pLKO_005 1913 3UTR 100% 13.200 18.480 N Arhgef25 n/a
4 TRCN0000120373 CGTGACTTTCTCAACGCATTA pLKO.1 1549 CDS 100% 10.800 15.120 N Arhgef25 n/a
5 TRCN0000340838 GTGACTTTCTCAACGCATTAC pLKO_005 1550 CDS 100% 10.800 15.120 N Arhgef25 n/a
6 TRCN0000340772 ACCTAAGCGATGCAATGATAT pLKO_005 1131 CDS 100% 13.200 10.560 N Arhgef25 n/a
7 TRCN0000120374 AGTGTTTGAAAGATCCCGATT pLKO.1 824 CDS 100% 4.050 3.240 N Arhgef25 n/a
8 TRCN0000340840 TGTCTTCCTGTTCGAGCAAAT pLKO_005 1284 CDS 100% 10.800 7.560 N Arhgef25 n/a
9 TRCN0000120375 CCAACTTTAACCACAGGACAA pLKO.1 472 CDS 100% 4.050 2.835 N Arhgef25 n/a
10 TRCN0000120376 GCATTACAGTCACCCATTGAA pLKO.1 1564 CDS 100% 5.625 3.375 N Arhgef25 n/a
11 TRCN0000230916 ATGAGTGGCACCGAGACTATT pLKO_005 785 CDS 100% 13.200 10.560 N ARHGEF25 n/a
12 TRCN0000021610 GCTCTGGAAAGGAGTATGTAT pLKO.1 613 CDS 100% 5.625 3.938 N ARHGEF25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166413.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13049 pDONR223 100% 67.4% 69.8% None (many diffs) n/a
2 ccsbBroad304_13049 pLX_304 0% 67.4% 69.8% V5 (many diffs) n/a
3 TRCN0000480524 AAAGTCTAGGAAATCGATCGGCCC pLX_317 25.3% 67.4% 69.8% V5 (many diffs) n/a
Download CSV