Transcript: Mouse NM_145595.2

Mus musculus carbonyl reductase 4 (Cbr4), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Cbr4 (234309)
Length:
1115
CDS:
116..826

Additional Resources:

NCBI RefSeq record:
NM_145595.2
NBCI Gene record:
Cbr4 (234309)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145595.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348650 GATTGCAGCTCACCGTCTAAT pLKO_005 807 CDS 100% 13.200 18.480 N Cbr4 n/a
2 TRCN0000099163 GAGAAACATTTAGGTCCAGTA pLKO.1 326 CDS 100% 4.050 5.670 N Cbr4 n/a
3 TRCN0000099161 CCAGGATTTATTCGCACGGAT pLKO.1 644 CDS 100% 2.640 3.696 N Cbr4 n/a
4 TRCN0000348582 ATTCAGCAGGGAGGGTCTATT pLKO_005 482 CDS 100% 13.200 10.560 N Cbr4 n/a
5 TRCN0000348651 CAAGATGTTCAGAGTACATTT pLKO_005 296 CDS 100% 13.200 9.240 N Cbr4 n/a
6 TRCN0000099164 CCATACATCACAGGCCATGTT pLKO.1 770 CDS 100% 4.950 3.465 N Cbr4 n/a
7 TRCN0000351785 CCATACATCACAGGCCATGTT pLKO_005 770 CDS 100% 4.950 3.465 N Cbr4 n/a
8 TRCN0000099160 CTCATCTATATGGGTGACATT pLKO.1 892 3UTR 100% 4.950 3.465 N Cbr4 n/a
9 TRCN0000351786 CTCATCTATATGGGTGACATT pLKO_005 892 3UTR 100% 4.950 3.465 N Cbr4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145595.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09231 pDONR223 100% 85% 86.4% None (many diffs) n/a
2 ccsbBroad304_09231 pLX_304 0% 85% 86.4% V5 (many diffs) n/a
3 TRCN0000470562 TTGTAGATAGGATCATCGACATTA pLX_317 51.8% 85% 86.4% V5 (many diffs) n/a
4 ccsbBroadEn_04435 pDONR223 100% 84.8% 86% None (many diffs) n/a
5 ccsbBroad304_04435 pLX_304 0% 84.8% 86% V5 (many diffs) n/a
6 TRCN0000474263 TACTCCCTCTCAGTCCGGCTGGTA pLX_317 79.7% 84.8% 86% V5 (many diffs) n/a
Download CSV