Transcript: Mouse NM_146042.4

Mus musculus ring finger protein 144B (Rnf144b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rnf144b (218215)
Length:
4576
CDS:
181..1086

Additional Resources:

NCBI RefSeq record:
NM_146042.4
NBCI Gene record:
Rnf144b (218215)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146042.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374680 ATGATCCATCCACAACCTAAA pLKO_005 1067 CDS 100% 10.800 15.120 N Rnf144b n/a
2 TRCN0000040951 CCGCATTTACATTGAGCGCAA pLKO.1 762 CDS 100% 2.160 3.024 N Rnf144b n/a
3 TRCN0000374742 GGAAGGATGATACTGCATAAT pLKO_005 1528 3UTR 100% 13.200 10.560 N Rnf144b n/a
4 TRCN0000336258 CCTGGCCTCTCCCTGTATAAT pLKO_005 1005 CDS 100% 15.000 10.500 N Rnf144b n/a
5 TRCN0000336317 AGAACCTGGACAATGACATAT pLKO_005 845 CDS 100% 13.200 9.240 N Rnf144b n/a
6 TRCN0000336260 CCAGACCGTGTGCCATATTTC pLKO_005 558 CDS 100% 13.200 9.240 N Rnf144b n/a
7 TRCN0000336259 CACTGTAGTCATGGCGGTATT pLKO_005 1421 3UTR 100% 10.800 7.560 N Rnf144b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146042.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13471 pDONR223 100% 84.1% 87.7% None (many diffs) n/a
2 ccsbBroad304_13471 pLX_304 0% 84.1% 87.7% V5 (many diffs) n/a
3 TRCN0000466705 GCCCTGCAGACGTGCTATTAGCGG pLX_317 37.9% 84.1% 87.7% V5 (many diffs) n/a
Download CSV