Transcript: Mouse NM_153543.2

Mus musculus aldehyde dehydrogenase 1 family, member L2 (Aldh1l2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Aldh1l2 (216188)
Length:
6030
CDS:
127..2898

Additional Resources:

NCBI RefSeq record:
NM_153543.2
NBCI Gene record:
Aldh1l2 (216188)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153543.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174996 GACACTAATCATGGGAGATAA pLKO.1 555 CDS 100% 13.200 18.480 N Aldh1l2 n/a
2 TRCN0000176358 CGGCCCTAAATTGATGAGATT pLKO.1 3729 3UTR 100% 4.950 6.930 N Aldh1l2 n/a
3 TRCN0000175465 CGCTTTATAACCGGTTCCTTT pLKO.1 677 CDS 100% 4.950 3.960 N Aldh1l2 n/a
4 TRCN0000216768 GGTGTTGCAGAGAGCAAATAA pLKO.1 2655 CDS 100% 15.000 10.500 N Aldh1l2 n/a
5 TRCN0000174496 CGATACAACTAAACACACAAA pLKO.1 5108 3UTR 100% 4.950 3.465 N Aldh1l2 n/a
6 TRCN0000194342 CTTGCCAAGGAGGAATCCTTT pLKO.1 2587 CDS 100% 0.495 0.347 N Aldh1l2 n/a
7 TRCN0000193493 GACATCAACAAAGCCATGTAT pLKO.1 2713 CDS 100% 5.625 3.375 N Aldh1l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153543.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10320 pDONR223 100% 45.1% 47.7% None (many diffs) n/a
2 ccsbBroad304_10320 pLX_304 0% 45.1% 47.7% V5 (many diffs) n/a
3 TRCN0000474398 TGCAGATCTCCTTCAACGTGGCGC pLX_317 35% 45.1% 47.7% V5 (many diffs) n/a
Download CSV