Transcript: Mouse NM_029239.3

Mus musculus protein kinase D3 (Prkd3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Prkd3 (75292)
Length:
5884
CDS:
763..3432

Additional Resources:

NCBI RefSeq record:
NM_029239.3
NBCI Gene record:
Prkd3 (75292)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029239.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024184 CCGCAAGATTTCACCAGCATT pLKO.1 2173 CDS 100% 4.950 6.930 N Prkd3 n/a
2 TRCN0000024188 GCATTGGAGAACGTTACATTA pLKO.1 3299 CDS 100% 13.200 9.240 N Prkd3 n/a
3 TRCN0000196960 GTGGATTCTTTGGCATGTATG pLKO.1 1061 CDS 100% 10.800 7.560 N PRKD3 n/a
4 TRCN0000024185 GCCACGACATGAACTCAGAAA pLKO.1 1100 CDS 100% 4.950 3.465 N Prkd3 n/a
5 TRCN0000024186 GCCCGAAGACAAGATGTTCTT pLKO.1 1857 CDS 100% 4.950 3.465 N Prkd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029239.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491418 CGTGTGCGTCACAACTAAGAGGCT pLX_317 15.3% 89.5% 95.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489087 ACCCGAAGAGGCTTTAATACACGG pLX_317 13.8% 89.5% 95.5% V5 (many diffs) n/a
3 ccsbBroadEn_14093 pDONR223 100% 59.9% 62.5% None (many diffs) n/a
4 ccsbBroadEn_15023 pDONR223 0% 59.7% 62% None (many diffs) n/a
5 ccsbBroad304_15023 pLX_304 0% 59.7% 62% V5 (many diffs) n/a
Download CSV