Transcript: Mouse NM_001170552.1

Mus musculus KRIT1, ankyrin repeat containing (Krit1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Krit1 (79264)
Length:
6034
CDS:
368..2461

Additional Resources:

NCBI RefSeq record:
NM_001170552.1
NBCI Gene record:
Krit1 (79264)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001170552.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072879 CGGGTAGATAAAGTGGTAATA pLKO.1 1094 CDS 100% 13.200 10.560 N KRIT1 n/a
2 TRCN0000291540 CGGGTAGATAAAGTGGTAATA pLKO_005 1094 CDS 100% 13.200 10.560 N KRIT1 n/a
3 TRCN0000105935 GCTCATAAGCTCTTCTAATTT pLKO.1 2648 3UTR 100% 15.000 10.500 N Krit1 n/a
4 TRCN0000325213 GCTCATAAGCTCTTCTAATTT pLKO_005 2648 3UTR 100% 15.000 10.500 N Krit1 n/a
5 TRCN0000105938 CCTTGTGGTAAAGCTGCTAAT pLKO.1 2398 CDS 100% 10.800 7.560 N Krit1 n/a
6 TRCN0000325134 CCTTGTGGTAAAGCTGCTAAT pLKO_005 2398 CDS 100% 10.800 7.560 N Krit1 n/a
7 TRCN0000072881 GCCTTGGATAAGTGGTTAGAT pLKO.1 842 CDS 100% 5.625 3.938 N KRIT1 n/a
8 TRCN0000291592 GCCTTGGATAAGTGGTTAGAT pLKO_005 842 CDS 100% 5.625 3.938 N KRIT1 n/a
9 TRCN0000105937 CCTGTGTATGTAGGAGTGAAT pLKO.1 2336 CDS 100% 4.950 3.465 N Krit1 n/a
10 TRCN0000325212 CCTGTGTATGTAGGAGTGAAT pLKO_005 2336 CDS 100% 4.950 3.465 N Krit1 n/a
11 TRCN0000105936 CGTACCTATTACTAAACTGAA pLKO.1 2119 CDS 100% 4.950 3.465 N Krit1 n/a
12 TRCN0000325211 CGTACCTATTACTAAACTGAA pLKO_005 2119 CDS 100% 4.950 3.465 N Krit1 n/a
13 TRCN0000105939 GCCTCACTGGATAAACCGAAT pLKO.1 2149 CDS 100% 4.050 2.835 N Krit1 n/a
14 TRCN0000325214 GCCTCACTGGATAAACCGAAT pLKO_005 2149 CDS 100% 4.050 2.835 N Krit1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170552.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00235 pDONR223 100% 85.4% 89.8% None (many diffs) n/a
2 ccsbBroad304_00235 pLX_304 0% 85.4% 89.8% V5 (many diffs) n/a
3 TRCN0000476066 ATACCCCCAGCCGATTAGTACTCT pLX_317 16.2% 85.4% 89.8% V5 (many diffs) n/a
Download CSV