Transcript: Human NM_020981.3

Homo sapiens beta-1,3-galactosyltransferase 1 (B3GALT1), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
B3GALT1 (8708)
Length:
2168
CDS:
352..1332

Additional Resources:

NCBI RefSeq record:
NM_020981.3
NBCI Gene record:
B3GALT1 (8708)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020981.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433562 CTTATCAACGAGCCCAATAAA pLKO_005 547 CDS 100% 15.000 21.000 N B3GALT1 n/a
2 TRCN0000419412 CCGATGTAGCTGAACTCATTT pLKO_005 1085 CDS 100% 13.200 18.480 N B3GALT1 n/a
3 TRCN0000035800 GCACAGAATCTGGAATGACAT pLKO.1 1284 CDS 100% 4.950 3.960 N B3GALT1 n/a
4 TRCN0000035803 GCTCTCTGGTACTTGAGTATA pLKO.1 406 CDS 100% 13.200 9.240 N B3GALT1 n/a
5 TRCN0000035802 CCAAGCCACGAAGAAGGTATT pLKO.1 938 CDS 100% 10.800 7.560 N B3GALT1 n/a
6 TRCN0000018789 CAACATAAGAACTCGACCTAT pLKO.1 504 CDS 100% 4.950 3.465 N B3galt1 n/a
7 TRCN0000035801 GCAAGAAACATCTCAGATGTT pLKO.1 1310 CDS 100% 0.495 0.347 N B3GALT1 n/a
8 TRCN0000035799 GCCTACAGTTTGTGTAGGTAT pLKO.1 1222 CDS 100% 0.495 0.347 N B3GALT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020981.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01996 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01996 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477881 AACCAACCCAATCGCGCTCTTCGC pLX_317 37.3% 100% 100% V5 n/a
Download CSV