Transcript: Human NM_001193637.1

Homo sapiens dehydrogenase/reductase 4 like 2 (DHRS4L2), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
DHRS4L2 (317749)
Length:
1462
CDS:
635..907

Additional Resources:

NCBI RefSeq record:
NM_001193637.1
NBCI Gene record:
DHRS4L2 (317749)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001193637.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028117 CCCTTTCTTTGGAAGCCTAAT pLKO.1 691 CDS 100% 10.800 6.480 N DHRS4L2 n/a
2 TRCN0000028073 GCCTGCACCTGGACTTATCAA pLKO.1 834 CDS 100% 5.625 3.375 N DHRS4L2 n/a
3 TRCN0000372100 TTACTGTTCACCTCATCAAAT pLKO_005 1137 3UTR 100% 13.200 6.600 Y DHRS4L2 n/a
4 TRCN0000028111 GCTGCTGTCAACCCTTTCTTT pLKO.1 680 CDS 100% 5.625 2.813 Y DHRS4L2 n/a
5 TRCN0000372099 ATTGTGCTGGCATCGTGTCTT pLKO_005 947 3UTR 100% 4.950 2.475 Y DHRS4L2 n/a
6 TRCN0000028101 CCCAAGGAACATTAGGGTGAA pLKO.1 811 CDS 100% 4.050 2.025 Y DHRS4L2 n/a
7 TRCN0000221923 CATGAAAGAAACCCTGCGGAT pLKO.1 903 CDS 100% 2.160 1.080 Y DHRS4 n/a
8 TRCN0000028066 ACCTTACTGTTCACCTCATAA pLKO.1 1134 3UTR 100% 13.200 6.600 Y DHRS4L2 n/a
9 TRCN0000036686 CAGCAGAATGTGGACCAGGCA pLKO.1 527 5UTR 100% 0.220 0.110 Y LOC400197 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193637.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13573 pDONR223 100% 39.1% 39.1% None 0_1ins297;105_106ins123 n/a
2 ccsbBroad304_13573 pLX_304 0% 39.1% 39.1% V5 0_1ins297;105_106ins123 n/a
3 TRCN0000475299 CGTCATGAGGTAACATAAGATCTA pLX_317 41.4% 39.1% 39.1% V5 0_1ins297;105_106ins123 n/a
4 ccsbBroadEn_14058 pDONR223 100% 31.6% None (many diffs) n/a
5 ccsbBroad304_14058 pLX_304 0% 31.6% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000477836 TGAAGCAGCATCATATTTACTACA pLX_317 50.9% 31.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV