Transcript: Human NM_001190794.1

Homo sapiens neutrophil cytosolic factor 2 (NCF2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
NCF2 (4688)
Length:
2285
CDS:
276..1721

Additional Resources:

NCBI RefSeq record:
NM_001190794.1
NBCI Gene record:
NCF2 (4688)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001190794.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038931 CGGGACATGGTGTCTAAGAAA pLKO.1 1266 CDS 100% 5.625 3.938 N NCF2 n/a
2 TRCN0000038932 GCTATCAAAGACCTTAAAGAA pLKO.1 543 CDS 100% 5.625 3.938 N NCF2 n/a
3 TRCN0000038933 CCTGGTGTTATCAAAGGTGAA pLKO.1 1592 CDS 100% 4.050 2.835 N NCF2 n/a
4 TRCN0000038929 GCGCAACTACAGATTTGGAAA pLKO.1 1681 CDS 100% 4.950 2.970 N NCF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190794.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06619 pDONR223 100% 91.2% 91% None (many diffs) n/a
2 ccsbBroad304_06619 pLX_304 0% 91.2% 91% V5 (many diffs) n/a
3 TRCN0000468311 ACCCCAGCCTCCGTAGTACGATAC pLX_317 27.5% 91.2% 91% V5 (many diffs) n/a
Download CSV