Transcript: Human NM_001256030.1

Homo sapiens CD48 molecule (CD48), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-12-30
Taxon:
Homo sapiens (human)
Gene:
CD48 (962)
Length:
1537
CDS:
89..847

Additional Resources:

NCBI RefSeq record:
NM_001256030.1
NBCI Gene record:
CD48 (962)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256030.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438737 GGCGCACTGTACATCTCTAAG pLKO_005 362 CDS 100% 10.800 15.120 N CD48 n/a
2 TRCN0000057664 GTGTGCTTGAAACCACCCTTA pLKO.1 624 CDS 100% 4.050 5.670 N CD48 n/a
3 TRCN0000057667 GCGAGTCTGTAAACTACACCT pLKO.1 561 CDS 100% 2.640 3.696 N CD48 n/a
4 TRCN0000057663 CCTGAGAACTACAAACAACTA pLKO.1 236 CDS 100% 4.950 3.465 N CD48 n/a
5 TRCN0000417002 TCTAAGTACTTTGAATCCAAA pLKO_005 308 CDS 100% 4.950 3.465 N CD48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256030.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00260 pDONR223 100% 89.1% 81.8% None (many diffs) n/a
2 ccsbBroadEn_10719 pDONR223 100% 62.9% 58.7% None (many diffs) n/a
3 ccsbBroad304_10719 pLX_304 0% 62.9% 58.7% V5 (many diffs) n/a
4 TRCN0000474468 TCCCTCAATTGAGACCGAATCTGC pLX_317 70% 62.9% 58.7% V5 (many diffs) n/a
Download CSV