Transcript: Human NR_045789.1

Homo sapiens NOP2/Sun RNA methyltransferase 4 (NSUN4), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-02-28
Taxon:
Homo sapiens (human)
Gene:
NSUN4 (387338)
Length:
5303
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045789.1
NBCI Gene record:
NSUN4 (387338)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_045789.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164071 CGCGGAGACATCGATATAAGA pLKO.1 715 3UTR 100% 5.625 7.875 N NSUN4 n/a
2 TRCN0000160999 GCGGAGACATCGATATAAGAA pLKO.1 716 3UTR 100% 5.625 7.875 N NSUN4 n/a
3 TRCN0000164586 CGAACCTTCGATGCTTCACTT pLKO.1 1205 3UTR 100% 4.950 6.930 N NSUN4 n/a
4 TRCN0000161547 GCTAGGAAGATGGAGCTTTAA pLKO.1 3382 3UTR 100% 13.200 9.240 N NSUN4 n/a
5 TRCN0000160114 CGGCAATAAGAAGTAGAAGAT pLKO.1 2114 3UTR 100% 4.950 3.465 N NSUN4 n/a
6 TRCN0000163332 CTTCACAGCTATGTGCCTGAA pLKO.1 1474 3UTR 100% 4.050 2.835 N NSUN4 n/a
7 TRCN0000159182 GATGGAAATCAAGTTCGAGTT pLKO.1 1504 3UTR 100% 4.050 2.835 N NSUN4 n/a
8 TRCN0000097370 GCTGGTAATACCAAACCTCAT pLKO.1 1911 3UTR 100% 4.050 2.835 N Nsun4 n/a
9 TRCN0000160972 GCTGGTAATACCAAACCTCAT pLKO.1 1911 3UTR 100% 4.050 2.835 N NSUN4 n/a
10 TRCN0000309585 GCTGGTAATACCAAACCTCAT pLKO_005 1911 3UTR 100% 4.050 2.835 N Nsun4 n/a
11 TRCN0000161196 GCACTGGTCAATAACTTTGCT pLKO.1 1048 3UTR 100% 3.000 2.100 N NSUN4 n/a
12 TRCN0000160115 CCCTTTCTAAATGAAAGGTTT pLKO.1 4009 3UTR 100% 0.495 0.347 N NSUN4 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 143 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 143 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045789.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10083 pDONR223 100% 21.6% None (many diffs) n/a
2 ccsbBroad304_10083 pLX_304 0% 21.6% V5 (many diffs) n/a
3 TRCN0000478407 GCACAAGCCTGAAGCTTCGCTAGC pLX_317 29.7% 21.6% V5 (many diffs) n/a
Download CSV