Transcript: Mouse NM_001253887.1

Mus musculus amyloid beta (A4) precursor protein-binding, family B, member 1 (Apbb1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Apbb1 (11785)
Length:
1922
CDS:
149..1504

Additional Resources:

NCBI RefSeq record:
NM_001253887.1
NBCI Gene record:
Apbb1 (11785)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001253887.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375281 TGCTCAAGTGCCACGTGTTTC pLKO_005 798 CDS 100% 10.800 8.640 N Apbb1 n/a
2 TRCN0000106526 CCAAGTCTATTACCTGGGAAA pLKO.1 1000 CDS 100% 4.050 3.240 N Apbb1 n/a
3 TRCN0000375280 GCTGGAGGACGAGACTCTAAA pLKO_005 646 CDS 100% 13.200 9.240 N Apbb1 n/a
4 TRCN0000329014 CTTCCTCTGCCTGCTTGTTTG pLKO_005 1517 3UTR 100% 10.800 7.560 N Apbb1 n/a
5 TRCN0000106525 CCAGTGTTTGAGGTAGAGCAA pLKO.1 1745 3UTR 100% 2.640 1.848 N Apbb1 n/a
6 TRCN0000375279 TTCCTTCACAGAAGTCATTAC pLKO_005 1669 3UTR 100% 10.800 6.480 N Apbb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253887.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00076 pDONR223 100% 57.9% 60.7% None (many diffs) n/a
2 ccsbBroad304_00076 pLX_304 0% 57.9% 60.7% V5 (many diffs) n/a
3 TRCN0000479791 AAGTGCTCTTAAAATGCCCAGAAG pLX_317 19.9% 57.9% 60.7% V5 (many diffs) n/a
Download CSV