Transcript: Mouse XM_006497170.1

PREDICTED: Mus musculus estrogen-related receptor gamma (Esrrg), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Esrrg (26381)
Length:
5150
CDS:
98..1405

Additional Resources:

NCBI RefSeq record:
XM_006497170.1
NBCI Gene record:
Esrrg (26381)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497170.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418101 ACTCTGCGTACATAGTCAATA pLKO_005 1813 3UTR 100% 13.200 18.480 N Esrrg n/a
2 TRCN0000417802 GTCGAAGAATCTTAGAGTTTA pLKO_005 1471 3UTR 100% 13.200 18.480 N Esrrg n/a
3 TRCN0000422009 CAACAGACTGCACTGATATTT pLKO_005 1510 3UTR 100% 15.000 10.500 N Esrrg n/a
4 TRCN0000437688 GCAGGCCTTCTTGACCTAAAT pLKO_005 1046 CDS 100% 13.200 9.240 N Esrrg n/a
5 TRCN0000222439 CGAGAGTTGGTGGTTATCATT pLKO.1 848 CDS 100% 5.625 3.938 N Esrrg n/a
6 TRCN0000222435 GCATTCTTCAAGAGGACGATT pLKO.1 476 CDS 100% 4.950 3.465 N Esrrg n/a
7 TRCN0000222436 GCGCAGAATAGATGCTGAGAA pLKO.1 661 CDS 100% 4.950 3.465 N Esrrg n/a
8 TRCN0000222437 CCAGCACTTCTACAACATCAA pLKO.1 1324 CDS 100% 4.950 2.970 N Esrrg n/a
9 TRCN0000222438 CGAATGAATGTGAGATCACAA pLKO.1 528 CDS 100% 4.950 2.970 N Esrrg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497170.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488884 ACTAGTAATCTGCAACAAAAACCT pLX_317 31.1% 93.1% 100% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_10808 pDONR223 100% 91.7% 98.1% None (many diffs) n/a
3 ccsbBroad304_10808 pLX_304 0% 91.7% 98.1% V5 (many diffs) n/a
4 TRCN0000479885 GTCTCAAAGCGCGTTAGTGAGGAA pLX_317 30.6% 91.7% 98.1% V5 (many diffs) n/a
5 TRCN0000489295 TTTCACGAGATGAAAAACTTGAAA pLX_317 26% 91.6% 97.9% V5 (many diffs) n/a
Download CSV