Transcript: Mouse XM_006501057.1

PREDICTED: Mus musculus potassium voltage-gated channel, shaker-related subfamily, beta member 1 (Kcnab1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcnab1 (16497)
Length:
3092
CDS:
212..1438

Additional Resources:

NCBI RefSeq record:
XM_006501057.1
NBCI Gene record:
Kcnab1 (16497)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501057.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069327 CGTGGTGAACGAGATTGATAA pLKO.1 1372 CDS 100% 13.200 18.480 N Kcnab1 n/a
2 TRCN0000069323 GCTATCTGTAAATACGGATAA pLKO.1 2638 3UTR 100% 10.800 8.640 N Kcnab1 n/a
3 TRCN0000069325 CCAGTGGTTGAAGGAAAGAAT pLKO.1 1144 CDS 100% 5.625 3.375 N Kcnab1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501057.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07185 pDONR223 100% 81% 80.4% None (many diffs) n/a
2 ccsbBroad304_07185 pLX_304 0% 81% 80.4% V5 (many diffs) n/a
3 TRCN0000472464 CGGGTAAACTCCGGGTTGATGAAA pLX_317 27.2% 81% 80.4% V5 (many diffs) n/a
Download CSV