Transcript: Mouse NM_001286610.1

Mus musculus Rho GTPase activating protein 25 (Arhgap25), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Arhgap25 (232201)
Length:
3495
CDS:
441..2120

Additional Resources:

NCBI RefSeq record:
NM_001286610.1
NBCI Gene record:
Arhgap25 (232201)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286610.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200737 GCAAGGATATTGGCAATCTAA pLKO.1 2650 3UTR 100% 5.625 7.875 N Arhgap25 n/a
2 TRCN0000192525 GATCCAAAGAGTGATGACCAT pLKO.1 1187 CDS 100% 2.640 3.696 N Arhgap25 n/a
3 TRCN0000190509 GCTCTTGTTAGCACAGACTCT pLKO.1 1764 CDS 100% 2.640 2.112 N Arhgap25 n/a
4 TRCN0000190690 GCGGACTTCTACCTACGATAA pLKO.1 1667 CDS 100% 10.800 7.560 N Arhgap25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286610.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11434 pDONR223 100% 47% 46.7% None (many diffs) n/a
2 ccsbBroad304_11434 pLX_304 0% 47% 46.7% V5 (many diffs) n/a
3 TRCN0000479463 TGTCAACTCATTCAAAAGTAGCAC pLX_317 25% 47% 46.7% V5 (many diffs) n/a
Download CSV