Transcript: Human NM_001127328.2

Homo sapiens acyl-CoA dehydrogenase medium chain (ACADM), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
ACADM (34)
Length:
2635
CDS:
442..1719

Additional Resources:

NCBI RefSeq record:
NM_001127328.2
NBCI Gene record:
ACADM (34)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221930 CCGTGAACACATTGACAAGTA pLKO.1 1689 CDS 100% 4.950 6.930 N ACADM n/a
2 TRCN0000343892 CCGTGAACACATTGACAAGTA pLKO_005 1689 CDS 100% 4.950 6.930 N ACADM n/a
3 TRCN0000221931 GCCTATTATTATTGCTGGAAA pLKO.1 846 CDS 100% 4.950 6.930 N ACADM n/a
4 TRCN0000343960 GCCTATTATTATTGCTGGAAA pLKO_005 846 CDS 100% 4.950 6.930 N ACADM n/a
5 TRCN0000221929 CCTGAGAAGTATTTCTCGTTT pLKO.1 486 CDS 100% 0.495 0.693 N ACADM n/a
6 TRCN0000343959 CCTGAGAAGTATTTCTCGTTT pLKO_005 486 CDS 100% 0.495 0.693 N ACADM n/a
7 TRCN0000221932 GCTGGCTGAAATGGCAATGAA pLKO.1 1419 CDS 100% 5.625 3.938 N ACADM n/a
8 TRCN0000343961 GCTGGCTGAAATGGCAATGAA pLKO_005 1419 CDS 100% 5.625 3.938 N ACADM n/a
9 TRCN0000221933 GTGCAGATACTTGGAGGCAAT pLKO.1 1570 CDS 100% 4.050 2.835 N ACADM n/a
10 TRCN0000343965 GTGCAGATACTTGGAGGCAAT pLKO_005 1570 CDS 100% 4.050 2.835 N ACADM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00006 pDONR223 100% 99% 99% None 30_41del n/a
2 ccsbBroad304_00006 pLX_304 0% 99% 99% V5 30_41del n/a
3 TRCN0000481433 ATAGGATTAATGTACGTTCGTCCG pLX_317 33.9% 99% 99% V5 30_41del n/a
Download CSV