Transcript: Human NM_001270409.1

Homo sapiens lin-9 DREAM MuvB core complex component (LIN9), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-12-15
Taxon:
Homo sapiens (human)
Gene:
LIN9 (286826)
Length:
3240
CDS:
317..1888

Additional Resources:

NCBI RefSeq record:
NM_001270409.1
NBCI Gene record:
LIN9 (286826)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001270409.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233307 CAGCGGAGATATGCAACAATT pLKO_005 1412 CDS 100% 13.200 18.480 N LIN9 n/a
2 TRCN0000233304 ACGAAAGTTACAGCACGATTA pLKO_005 929 CDS 100% 10.800 15.120 N LIN9 n/a
3 TRCN0000121646 GCATTGAATTTCAGCGGAGAT pLKO.1 1401 CDS 100% 4.050 5.670 N LIN9 n/a
4 TRCN0000115874 CGCTTCTAATATCAGTTGCTT pLKO.1 1768 CDS 100% 3.000 4.200 N LIN9 n/a
5 TRCN0000115873 GCTTCTAATATCAGTTGCTTT pLKO.1 1769 CDS 100% 4.950 3.960 N LIN9 n/a
6 TRCN0000115872 CCACTGAAATATAGATGGGAA pLKO.1 2400 3UTR 100% 2.640 2.112 N LIN9 n/a
7 TRCN0000233308 ACATGGTTCTGTAGATCATTT pLKO_005 2463 3UTR 100% 13.200 9.240 N LIN9 n/a
8 TRCN0000115875 CCAGTCACCAATTATAGATAA pLKO.1 1180 CDS 100% 13.200 9.240 N LIN9 n/a
9 TRCN0000233305 TACTCTTAATGCTACTTATAG pLKO_005 997 CDS 100% 13.200 9.240 N LIN9 n/a
10 TRCN0000233306 TATCCAAGTGACCAGATTATC pLKO_005 1288 CDS 100% 13.200 9.240 N LIN9 n/a
11 TRCN0000115876 CCTGTTTGGAAAGGCAGGAAT pLKO.1 482 CDS 100% 4.950 3.465 N LIN9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270409.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05418 pDONR223 100% 93.7% 93.7% None 206_207ins105 n/a
2 ccsbBroad304_05418 pLX_304 0% 93.7% 93.7% V5 206_207ins105 n/a
3 TRCN0000477195 AGCCGCGAGTGTTGAGATGACAAT pLX_317 16.3% 93.7% 93.7% V5 206_207ins105 n/a
Download CSV