Transcript: Human NM_001277078.1

Homo sapiens homer scaffold protein 1 (HOMER1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
HOMER1 (9456)
Length:
3963
CDS:
1063..1596

Additional Resources:

NCBI RefSeq record:
NM_001277078.1
NBCI Gene record:
HOMER1 (9456)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001277078.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220012 GAGCATCATCTTTCGAAATTT pLKO.1 1339 CDS 100% 15.000 21.000 N HOMER1 n/a
2 TRCN0000332980 GAGCATCATCTTTCGAAATTT pLKO_005 1339 CDS 100% 15.000 21.000 N HOMER1 n/a
3 TRCN0000147685 GCAGTGCCATTACCAATTAAT pLKO.1 2274 3UTR 100% 15.000 21.000 N HOMER1 n/a
4 TRCN0000220011 GTGTATAGGATAATCAGTTTA pLKO.1 1192 CDS 100% 13.200 18.480 N HOMER1 n/a
5 TRCN0000332915 GTGTATAGGATAATCAGTTTA pLKO_005 1192 CDS 100% 13.200 18.480 N HOMER1 n/a
6 TRCN0000434804 GTGTATAGGATAATCAGTTTA pLKO_005 1192 CDS 100% 13.200 18.480 N Homer1 n/a
7 TRCN0000147073 CCTGAAGACACTCTTAGAAAT pLKO.1 1688 3UTR 100% 13.200 10.560 N HOMER1 n/a
8 TRCN0000344519 CCTGAAGACACTCTTAGAAAT pLKO_005 1688 3UTR 100% 13.200 10.560 N HOMER1 n/a
9 TRCN0000183482 GCTGAGATATTTCTCTGATAA pLKO.1 3577 3UTR 100% 13.200 10.560 N HOMER1 n/a
10 TRCN0000220013 ACTAACAGAATTACGAGATAA pLKO.1 1730 3UTR 100% 13.200 9.240 N HOMER1 n/a
11 TRCN0000344520 CTAACAGAATTACGAGATAAC pLKO_005 1731 3UTR 100% 10.800 7.560 N HOMER1 n/a
12 TRCN0000148187 GCTGTAACATCATGTACGTTA pLKO.1 3484 3UTR 100% 4.950 3.465 N HOMER1 n/a
13 TRCN0000147896 GAGAAGATATTGTCTCCCATT pLKO.1 2478 3UTR 100% 4.050 2.835 N HOMER1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277078.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02169 pDONR223 100% 49.8% 49.4% None 528_529delGAinsTTC;531_532ins530 n/a
2 ccsbBroad304_02169 pLX_304 0% 49.8% 49.4% V5 528_529delGAinsTTC;531_532ins530 n/a
3 TRCN0000469856 ATACTATTTCAACTCCACATACCG pLX_317 45% 49.8% 49.4% V5 528_529delGAinsTTC;531_532ins530 n/a
4 TRCN0000488415 CCTTCGGACTAAATACTAGACATG pLX_317 29.2% 49.8% 49.4% V5 528_529delGAinsTTC;531_532ins530 n/a
5 TRCN0000489063 AGCGGGTCAATTATGCTTTGTAAA pLX_317 35.8% 49.8% 49.4% V5 (not translated due to prior stop codon) 528_529delGAinsTTC;531_532ins530 n/a
Download CSV