Transcript: Human NM_001305115.1

Homo sapiens dual specificity phosphatase 26 (DUSP26), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-04-01
Taxon:
Homo sapiens (human)
Gene:
DUSP26 (78986)
Length:
1849
CDS:
516..1151

Additional Resources:

NCBI RefSeq record:
NM_001305115.1
NBCI Gene record:
DUSP26 (78986)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001305115.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231635 GGGATACGGCAAGCATGAATG pLKO_005 1548 3UTR 100% 10.800 15.120 N DUSP26 n/a
2 TRCN0000002636 CAAAGACCACCGAGGCATCAT pLKO.1 1061 CDS 100% 4.950 3.960 N DUSP26 n/a
3 TRCN0000231634 CAAAGACCACCGAGGCATCAT pLKO_005 1061 CDS 100% 4.950 3.960 N DUSP26 n/a
4 TRCN0000355835 CTCTTTGTGCCCAAGTGTTTC pLKO_005 1468 3UTR 100% 10.800 7.560 N DUSP26 n/a
5 TRCN0000257333 CCAACCGTTCAACATCCTTTC pLKO_005 621 CDS 100% 6.000 4.200 N DUSP26 n/a
6 TRCN0000355832 ACTCGCCAGCCTTTGACATGA pLKO_005 874 CDS 100% 4.950 3.465 N DUSP26 n/a
7 TRCN0000002635 CAGCGAAGAGATGGTGTGAAA pLKO.1 1611 3UTR 100% 4.950 3.465 N DUSP26 n/a
8 TRCN0000231633 ATGCTGTACCACCACCTTACC pLKO_005 1017 CDS 100% 4.050 2.835 N DUSP26 n/a
9 TRCN0000355834 GCAAGACAGCCTGTAACCATG pLKO_005 679 CDS 100% 4.050 2.835 N DUSP26 n/a
10 TRCN0000231632 TCAAGGTCTCCTGTTCGAACT pLKO_005 579 CDS 100% 4.050 2.835 N DUSP26 n/a
11 TRCN0000002633 ACGTCCTCAATGCCTCACACA pLKO.1 784 CDS 100% 2.640 1.848 N DUSP26 n/a
12 TRCN0000002632 TCCTTTCCTCAATGTCTTCGA pLKO.1 635 CDS 100% 2.640 1.848 N DUSP26 n/a
13 TRCN0000002634 CGCCAGCCTTTGACATGAGCA pLKO.1 877 CDS 100% 0.880 0.616 N DUSP26 n/a
14 TRCN0000355899 GAGGGAAGATCCTGGTGCATT pLKO_005 949 CDS 100% 4.950 2.970 N DUSP26 n/a
15 TRCN0000355833 ACCAGGACATGGCTAACAACC pLKO_005 733 CDS 100% 4.050 2.430 N DUSP26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001305115.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04012 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04012 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473776 CCTTTAGAATGTTTTAAATAAAAT pLX_317 30.7% 100% 100% V5 n/a
4 TRCN0000489384 TGCGGGGTTCGTTTACACCGACCA pLX_317 58.4% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV