Transcript: Human XM_011514419.1

PREDICTED: Homo sapiens intestinal cell kinase (ICK), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CILK1 (22858)
Length:
6149
CDS:
380..2299

Additional Resources:

NCBI RefSeq record:
XM_011514419.1
NBCI Gene record:
CILK1 (22858)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514419.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320575 ATTACAAGGACTCGCATTTAT pLKO_005 706 CDS 100% 15.000 21.000 N CILK1 n/a
2 TRCN0000381365 GCAGCCAAGCAGCACTATTTG pLKO_005 1850 CDS 100% 13.200 18.480 N CILK1 n/a
3 TRCN0000006325 GCTTCTTTCATCGAGACTTAA pLKO.1 738 CDS 100% 13.200 18.480 N CILK1 n/a
4 TRCN0000320639 TACTTGCCTGGGATCAGTATA pLKO_005 1883 CDS 100% 13.200 18.480 N CILK1 n/a
5 TRCN0000199492 GAAGCACTCCTGGGTTGATAC pLKO.1 2208 CDS 100% 10.800 15.120 N CILK1 n/a
6 TRCN0000322185 TCGGGAGGTTAAGTCTTTAAA pLKO_005 523 CDS 100% 15.000 12.000 N Ick n/a
7 TRCN0000320577 CTATGTGATAGAGGGTTATTT pLKO_005 2719 3UTR 100% 15.000 10.500 N CILK1 n/a
8 TRCN0000379739 ACCATGCCAATGTAGTCAAAT pLKO_005 552 CDS 100% 13.200 9.240 N CILK1 n/a
9 TRCN0000320574 CCAAGCCACACACACGAATTT pLKO_005 1359 CDS 100% 13.200 9.240 N CILK1 n/a
10 TRCN0000199058 CCACAGTGTGTACCCAATAAC pLKO.1 1094 CDS 100% 13.200 9.240 N CILK1 n/a
11 TRCN0000006326 GTCAGTAATCAGCAAAGTAAA pLKO.1 1996 CDS 100% 13.200 9.240 N CILK1 n/a
12 TRCN0000320638 GTCAGTAATCAGCAAAGTAAA pLKO_005 1996 CDS 100% 13.200 9.240 N CILK1 n/a
13 TRCN0000381352 GCTAGTCAGGCACTTCGATAT pLKO_005 1202 CDS 100% 10.800 7.560 N CILK1 n/a
14 TRCN0000199681 GTGGACTGACTGGAAACTATG pLKO.1 2046 CDS 100% 10.800 7.560 N CILK1 n/a
15 TRCN0000006323 CCTACCATCAAGCCATTGTTT pLKO.1 5538 3UTR 100% 5.625 3.938 N CILK1 n/a
16 TRCN0000006324 CCAGTGAAATTGACACAATAT pLKO.1 987 CDS 100% 13.200 7.920 N CILK1 n/a
17 TRCN0000006327 CCAGCTCATTAAAGAGAGAAA pLKO.1 640 CDS 100% 4.950 2.970 N CILK1 n/a
18 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 3945 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
19 TRCN0000025945 CCAGTGAAATTGACACAATTT pLKO.1 987 CDS 100% 1.320 0.792 N Ick n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514419.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488354 ATATTTCAACAAGCACACTGTCCA pLX_317 18.8% 98.9% 98.9% V5 (not translated due to prior stop codon) 1153_1173del n/a
2 ccsbBroadEn_11636 pDONR223 100% 44.6% 44.2% None (many diffs) n/a
3 ccsbBroad304_11636 pLX_304 0% 44.6% 44.2% V5 (many diffs) n/a
4 TRCN0000467212 TTTCATTTTTATTCTGCGATCTAT pLX_317 54% 44.6% 44.2% V5 (many diffs) n/a
Download CSV