Transcript: Human XM_011540607.1

PREDICTED: Homo sapiens ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 (ACAP3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACAP3 (116983)
Length:
6232
CDS:
2518..5052

Additional Resources:

NCBI RefSeq record:
XM_011540607.1
NBCI Gene record:
ACAP3 (116983)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540607.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424659 ACTATGTGCTCCAGATCAATG pLKO_005 3056 CDS 100% 10.800 15.120 N ACAP3 n/a
2 TRCN0000438324 TGATCGACTCTGCGGTGGAAA pLKO_005 3224 CDS 100% 4.950 6.930 N ACAP3 n/a
3 TRCN0000155903 CAGAGCTTTGTCAAAGAGGAT pLKO.1 2869 CDS 100% 2.640 3.696 N ACAP3 n/a
4 TRCN0000157528 GCAACGCTTTCAAGACATGGA pLKO.1 3386 CDS 100% 2.640 2.112 N ACAP3 n/a
5 TRCN0000158197 CAAAGAGGATGTGCGGAAGTT pLKO.1 2880 CDS 100% 4.950 3.465 N ACAP3 n/a
6 TRCN0000157741 CCAGCAACGCTTTCAAGACAT pLKO.1 3383 CDS 100% 4.950 3.465 N ACAP3 n/a
7 TRCN0000424575 GCTCATGTCACAAGCCACTTT pLKO_005 5340 3UTR 100% 4.950 3.465 N ACAP3 n/a
8 TRCN0000156390 CGATGAGTCCAAAGTGGAGTT pLKO.1 3309 CDS 100% 4.050 2.835 N ACAP3 n/a
9 TRCN0000437572 TGTGAAGCCGTGTGAGGACAT pLKO_005 3504 CDS 100% 4.050 2.835 N ACAP3 n/a
10 TRCN0000438876 CAACGCTGACATCGTGACACT pLKO_005 4887 CDS 100% 2.640 1.848 N ACAP3 n/a
11 TRCN0000156962 GCAGGCCAAGAAGAAGTTTGA pLKO.1 3081 CDS 100% 4.950 2.970 N ACAP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540607.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09438 pDONR223 100% 96.5% 96.1% None (many diffs) n/a
2 ccsbBroad304_09438 pLX_304 0% 96.5% 96.1% V5 (many diffs) n/a
3 TRCN0000481075 CTGTTCATACGTCAGCGGCCGAGT pLX_317 18.4% 96.5% 96.1% V5 (many diffs) n/a
Download CSV