Transcript: Mouse XM_011238567.1

PREDICTED: Mus musculus spermatogenesis associated, serine-rich 2-like (Spats2l), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spats2l (67198)
Length:
3424
CDS:
23..1489

Additional Resources:

NCBI RefSeq record:
XM_011238567.1
NBCI Gene record:
Spats2l (67198)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238567.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263404 TTGTCAGCGAACGCAAGTATG pLKO_005 777 CDS 100% 10.800 15.120 N Spats2l n/a
2 TRCN0000216323 GGTACTCCAACAGTTTGATTT pLKO.1 115 CDS 100% 13.200 10.560 N Spats2l n/a
3 TRCN0000282607 GGTTTCACAGTGCAATCTTTG pLKO_005 1399 CDS 100% 10.800 8.640 N Spats2l n/a
4 TRCN0000217170 CGAACTCAGAGCTGAAATTAA pLKO.1 751 CDS 100% 15.000 10.500 N Spats2l n/a
5 TRCN0000263403 TCCATATTCTGACACTATATT pLKO_005 2317 3UTR 100% 15.000 10.500 N Spats2l n/a
6 TRCN0000263405 TCCAGCCAAAGACGAAGATTT pLKO_005 1106 CDS 100% 13.200 9.240 N Spats2l n/a
7 TRCN0000282603 GTTCCGTGAAGAAGATCAAAG pLKO_005 558 CDS 100% 10.800 7.560 N Spats2l n/a
8 TRCN0000201273 GCAATCTTTGTCCCTCTAGAA pLKO.1 1410 CDS 100% 4.950 3.465 N Spats2l n/a
9 TRCN0000192677 GCCAGCCAGTATTTACTCATT pLKO.1 1720 3UTR 100% 4.950 3.465 N Spats2l n/a
10 TRCN0000216063 CAGTGCTATTCAAGTTCTTAA pLKO.1 172 CDS 100% 13.200 7.920 N Spats2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238567.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11798 pDONR223 100% 87.1% 89.5% None (many diffs) n/a
2 ccsbBroad304_11798 pLX_304 0% 87.1% 89.5% V5 (many diffs) n/a
3 TRCN0000471007 CAGACCAACGATTAGCTAACTTTT pLX_317 25% 87.1% 89.5% V5 (many diffs) n/a
Download CSV