Transcript: Mouse XM_006539234.2

PREDICTED: Mus musculus splA/ryanodine receptor domain and SOCS box containing 1 (Spsb1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spsb1 (74646)
Length:
3216
CDS:
464..1285

Additional Resources:

NCBI RefSeq record:
XM_006539234.2
NBCI Gene record:
Spsb1 (74646)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539234.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241423 GGCAAGAACCAGCCAAGTAAA pLKO_005 920 CDS 100% 13.200 18.480 N Spsb1 n/a
2 TRCN0000190031 GTTGGGTACACAACCCTTGTA pLKO.1 842 CDS 100% 4.950 6.930 N Spsb1 n/a
3 TRCN0000241420 GCTCCACTCCTGGAACAATAA pLKO_005 619 CDS 100% 13.200 9.240 N Spsb1 n/a
4 TRCN0000219558 CATGGATGATGGGACCTTAAG pLKO.1 1009 CDS 100% 10.800 7.560 N Spsb1 n/a
5 TRCN0000241422 TCCTCTACCAGTGATCCAAAT pLKO_005 1272 CDS 100% 10.800 7.560 N Spsb1 n/a
6 TRCN0000191850 GCAGAGAATAAACTATGAGAA pLKO.1 1510 3UTR 100% 4.950 3.465 N Spsb1 n/a
7 TRCN0000241421 TGGCCATCCTGGGCTATATTA pLKO_005 2615 3UTR 100% 15.000 9.000 N Spsb1 n/a
8 TRCN0000241419 CACACGTGGACTGCATGTATG pLKO_005 742 CDS 100% 10.800 6.480 N Spsb1 n/a
9 TRCN0000190191 CGAGACATTCATTGTCCCTGA pLKO.1 967 CDS 100% 2.160 1.296 N Spsb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539234.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09009 pDONR223 100% 88.4% 97.8% None (many diffs) n/a
2 ccsbBroad304_09009 pLX_304 0% 88.4% 97.8% V5 (many diffs) n/a
3 TRCN0000481173 CTCTACCGGTGATGCGTCAGTCGT pLX_317 59.7% 88.4% 97.8% V5 (many diffs) n/a
Download CSV