Transcript: Mouse XM_011250231.1

PREDICTED: Mus musculus AT hook, DNA binding motif, containing 1 (Ahdc1), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ahdc1 (230793)
Length:
6784
CDS:
1069..5853

Additional Resources:

NCBI RefSeq record:
XM_011250231.1
NBCI Gene record:
Ahdc1 (230793)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250231.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193759 CCACGTACAAAGTTTCATCCT pLKO.1 2531 CDS 100% 2.640 3.696 N Ahdc1 n/a
2 TRCN0000241820 TACAGGTATCCAGGCTTTATG pLKO_005 5731 CDS 100% 13.200 10.560 N Ahdc1 n/a
3 TRCN0000240747 TGGTCCCGTGGTGTGCAAATT pLKO_005 6343 3UTR 100% 13.200 10.560 N AHDC1 n/a
4 TRCN0000241817 TGGTCCCGTGGTGTGCAAATT pLKO_005 6343 3UTR 100% 13.200 10.560 N Ahdc1 n/a
5 TRCN0000241818 CTCACCCTGAGGACACATTTA pLKO_005 5816 CDS 100% 13.200 9.240 N Ahdc1 n/a
6 TRCN0000217704 GAACCTCTTCACTGGCTATTT pLKO.1 3555 CDS 100% 13.200 9.240 N Ahdc1 n/a
7 TRCN0000241821 GAACCTCTTCACTGGCTATTT pLKO_005 3555 CDS 100% 13.200 9.240 N Ahdc1 n/a
8 TRCN0000241819 CCTAGATACCCTACCTGATTC pLKO_005 2013 CDS 100% 10.800 7.560 N Ahdc1 n/a
9 TRCN0000240746 CCTTTAGTCAGCTCTACAATC pLKO_005 4415 CDS 100% 10.800 7.560 N AHDC1 n/a
10 TRCN0000168299 GCCTTTAGTCAGCTCTACAAT pLKO.1 4414 CDS 100% 5.625 3.938 N AHDC1 n/a
11 TRCN0000193714 CCAATGACAGTAAGGCTGAAT pLKO.1 2873 CDS 100% 4.950 3.465 N Ahdc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250231.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11858 pDONR223 100% 22.4% 24% None (many diffs) n/a
2 ccsbBroad304_11858 pLX_304 0% 22.4% 24% V5 (many diffs) n/a
3 TRCN0000480729 ACTTAAGTTCTTTCTTATGTAATC pLX_317 26.4% 22.4% 24% V5 (many diffs) n/a
Download CSV