Transcript: Human NM_001308217.1

Homo sapiens potassium voltage-gated channel subfamily A member regulatory beta subunit 1 (KCNAB1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
KCNAB1 (7881)
Length:
3242
CDS:
65..1237

Additional Resources:

NCBI RefSeq record:
NM_001308217.1
NBCI Gene record:
KCNAB1 (7881)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308217.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044790 GCTGTCAAGAAAGCATATTAT pLKO.1 610 CDS 100% 15.000 10.500 N KCNAB1 n/a
2 TRCN0000044788 CGCCTATGAAAGTGGTGTTAA pLKO.1 445 CDS 100% 13.200 9.240 N KCNAB1 n/a
3 TRCN0000044791 CCAGTGGTTGAAAGAAAGAAT pLKO.1 943 CDS 100% 5.625 3.938 N KCNAB1 n/a
4 TRCN0000044792 CTCCTGAACAACTCATTGAAA pLKO.1 1110 CDS 100% 5.625 3.938 N KCNAB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308217.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07185 pDONR223 100% 80.9% 75.2% None (many diffs) n/a
2 ccsbBroad304_07185 pLX_304 0% 80.9% 75.2% V5 (many diffs) n/a
3 TRCN0000472464 CGGGTAAACTCCGGGTTGATGAAA pLX_317 27.2% 80.9% 75.2% V5 (many diffs) n/a
Download CSV