Transcript: Human NM_001308051.1

Homo sapiens prune homolog 2 with BCH domain (PRUNE2), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-01-12
Taxon:
Homo sapiens (human)
Gene:
PRUNE2 (158471)
Length:
4458
CDS:
275..1249

Additional Resources:

NCBI RefSeq record:
NM_001308051.1
NBCI Gene record:
PRUNE2 (158471)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308051.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156077 CCCAATGGATTGCATCCACAT pLKO.1 1180 CDS 100% 4.050 5.670 N PRUNE2 n/a
2 TRCN0000154470 GCGCATTGACATGAAGGTCAT pLKO.1 745 CDS 100% 4.050 5.670 N PRUNE2 n/a
3 TRCN0000151765 CCTTCTTAGAAGCACTTCTTT pLKO.1 2760 3UTR 100% 5.625 3.938 N PRUNE2 n/a
4 TRCN0000155484 GCCAACAAAGATTCTGGCCAA pLKO.1 635 CDS 100% 2.160 1.512 N PRUNE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308051.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13308 pDONR223 100% 56.4% 57% None (many diffs) n/a
2 ccsbBroad304_13308 pLX_304 0% 56.4% 57% V5 (many diffs) n/a
3 TRCN0000471170 ATCTCCTTCTAATACTGGGGTTTC pLX_317 77.5% 56.4% 57% V5 (many diffs) n/a
Download CSV