Transcript: Human NM_001077206.3

Homo sapiens SEC31 homolog A, COPII coat complex component (SEC31A), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
SEC31A (22872)
Length:
4114
CDS:
198..3518

Additional Resources:

NCBI RefSeq record:
NM_001077206.3
NBCI Gene record:
SEC31A (22872)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001077206.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149552 GCAGGACATGAATCACCTAAA pLKO.1 2580 CDS 100% 10.800 8.640 N SEC31A n/a
2 TRCN0000420637 CAGACTGCTCAGCATAGTATA pLKO_005 1314 CDS 100% 13.200 9.240 N SEC31A n/a
3 TRCN0000412600 CAGCAATTGGATGCAACATTT pLKO_005 288 CDS 100% 13.200 9.240 N SEC31A n/a
4 TRCN0000147723 GACCACATTTGAGGATCTTAT pLKO.1 3215 CDS 100% 13.200 9.240 N SEC31A n/a
5 TRCN0000436177 AGATGTGGGATCTTCGATTTG pLKO_005 922 CDS 100% 10.800 7.560 N SEC31A n/a
6 TRCN0000148139 GCAGTCACAAGGATTTATCAA pLKO.1 1544 CDS 100% 5.625 3.938 N SEC31A n/a
7 TRCN0000150174 GCTGATATACTCACCTTAGAA pLKO.1 3653 3UTR 100% 5.625 3.938 N SEC31A n/a
8 TRCN0000146890 CCTCATTAGCATGTTTGCATA pLKO.1 3601 3UTR 100% 4.950 3.465 N SEC31A n/a
9 TRCN0000148426 CTCTGATCCATCCTTGGATAT pLKO.1 347 CDS 100% 1.080 0.756 N SEC31A n/a
10 TRCN0000149348 GCTAAGATTCTCTGCTCCAAT pLKO.1 1044 CDS 100% 4.950 2.475 Y SEC31A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077206.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11637 pDONR223 100% 45.7% 45.4% None (many diffs) n/a
2 ccsbBroad304_11637 pLX_304 0% 45.7% 45.4% V5 (many diffs) n/a
3 TRCN0000470763 CGCATTTGAGGATCCGCAGCACAG pLX_317 27.7% 45.7% 45.4% V5 (many diffs) n/a
Download CSV