Transcript: Human NM_001317781.1

Homo sapiens sorting nexin 25 (SNX25), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
SNX25 (83891)
Length:
3331
CDS:
295..2817

Additional Resources:

NCBI RefSeq record:
NM_001317781.1
NBCI Gene record:
SNX25 (83891)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317781.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229922 GTCTCTCAGCTTACGTATAAT pLKO_005 660 CDS 100% 15.000 21.000 N SNX25 n/a
2 TRCN0000229923 GACCCTAAAGGATAGGTATTA pLKO_005 1437 CDS 100% 13.200 18.480 N SNX25 n/a
3 TRCN0000229925 GGCTTAACTGAGAACCGTATT pLKO_005 2892 3UTR 100% 10.800 15.120 N SNX25 n/a
4 TRCN0000148091 GTGAGAACCTAGGAAGTATTT pLKO.1 3077 3UTR 100% 13.200 10.560 N SNX25 n/a
5 TRCN0000218217 GAAGCAACTAAGGTATCAAAT pLKO_005 882 CDS 100% 13.200 9.240 N SNX25 n/a
6 TRCN0000183563 GAGGACTGTGAACATTCTTAT pLKO.1 3164 3UTR 100% 13.200 9.240 N SNX25 n/a
7 TRCN0000147642 GAGGACTTTACTCACTCATTT pLKO.1 486 CDS 100% 13.200 9.240 N SNX25 n/a
8 TRCN0000229924 CCTGACTACCTCAAGGTTATC pLKO_005 2167 CDS 100% 10.800 7.560 N SNX25 n/a
9 TRCN0000147517 GATTACATTCTGTCCTGGTAT pLKO.1 337 CDS 100% 4.950 3.465 N SNX25 n/a
10 TRCN0000147986 CCATGTTACTTTGTCATGGTA pLKO.1 1876 CDS 100% 0.300 0.210 N SNX25 n/a
11 TRCN0000379500 CACAATTAGTTGGTGAAATTT pLKO_005 1289 CDS 100% 15.000 9.000 N SNX25 n/a
12 TRCN0000183758 CCACAATTAGTTGGTGAAATT pLKO.1 1288 CDS 100% 13.200 7.920 N SNX25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317781.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14299 pDONR223 100% 66.1% 66% None (many diffs) n/a
2 ccsbBroad304_14299 pLX_304 0% 66.1% 66% V5 (many diffs) n/a
3 TRCN0000476385 CTGCAAATATAGATCAGTGTTTCA pLX_317 21.7% 66.1% 66% V5 (many diffs) n/a
Download CSV