Transcript: Human NM_001326316.1

Homo sapiens zinc finger CCCH-type containing 14 (ZC3H14), transcript variant 28, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
ZC3H14 (79882)
Length:
4039
CDS:
176..2281

Additional Resources:

NCBI RefSeq record:
NM_001326316.1
NBCI Gene record:
ZC3H14 (79882)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001326316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128743 CGTATGGCTTCATGGTGTATT pLKO.1 262 CDS 100% 13.200 18.480 N ZC3H14 n/a
2 TRCN0000297723 CGTATGGCTTCATGGTGTATT pLKO_005 262 CDS 100% 13.200 18.480 N ZC3H14 n/a
3 TRCN0000215959 CTCTGAAGATGTGATTGATAT pLKO.1 574 CDS 100% 13.200 9.240 N Zc3h14 n/a
4 TRCN0000129229 CCATGCAGACACAAGATCATT pLKO.1 1453 CDS 100% 5.625 3.938 N ZC3H14 n/a
5 TRCN0000343635 CCATGCAGACACAAGATCATT pLKO_005 1453 CDS 100% 5.625 3.938 N ZC3H14 n/a
6 TRCN0000128105 CCGTTACTTCCCTGCTTGTAA pLKO.1 2116 CDS 100% 5.625 3.938 N ZC3H14 n/a
7 TRCN0000343697 CCGTTACTTCCCTGCTTGTAA pLKO_005 2116 CDS 100% 5.625 3.938 N ZC3H14 n/a
8 TRCN0000128765 CCAGGATACATGTCAGATCAA pLKO.1 1658 CDS 100% 4.950 3.465 N ZC3H14 n/a
9 TRCN0000173125 CACCTTATGCAGACACGAGAT pLKO.1 1571 CDS 100% 4.050 2.835 N Zc3h14 n/a
10 TRCN0000341193 CACCTTATGCAGACACGAGAT pLKO_005 1571 CDS 100% 4.050 2.835 N Zc3h14 n/a
11 TRCN0000129186 CCAGATGATCTCATTGACGAA pLKO.1 605 CDS 100% 2.640 1.848 N ZC3H14 n/a
12 TRCN0000279787 CCAGATGATCTCATTGACGAA pLKO_005 605 CDS 100% 2.640 1.848 N ZC3H14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001326316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04145 pDONR223 100% 37.5% 29.7% None (many diffs) n/a
2 ccsbBroad304_04145 pLX_304 0% 37.5% 29.7% V5 (many diffs) n/a
3 TRCN0000470306 CTTTCGGACTTCGTTGACTCCACG pLX_317 55.1% 37.5% 29.7% V5 (many diffs) n/a
Download CSV