Transcript: Human XM_017006203.1

PREDICTED: Homo sapiens solute carrier family 9 member A9 (SLC9A9), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC9A9 (285195)
Length:
2631
CDS:
319..1905

Additional Resources:

NCBI RefSeq record:
XM_017006203.1
NBCI Gene record:
SLC9A9 (285195)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006203.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043832 GCATCGTCATAGGGTTAATTA pLKO.1 488 CDS 100% 15.000 10.500 N SLC9A9 n/a
2 TRCN0000043828 CCCTCCATTAAGGAGAGTTTA pLKO.1 2272 3UTR 100% 13.200 9.240 N SLC9A9 n/a
3 TRCN0000413015 TTGCCAGAGCCTGCAACATAT pLKO_005 1184 CDS 100% 13.200 9.240 N SLC9A9 n/a
4 TRCN0000043831 CGGCTCTTCAGAATGTGGTAT pLKO.1 1537 CDS 100% 4.950 3.465 N SLC9A9 n/a
5 TRCN0000043829 GCCATAAATTACCAGGAGCAA pLKO.1 1729 CDS 100% 2.640 1.848 N SLC9A9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006203.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05391 pDONR223 100% 81.3% 80.2% None (many diffs) n/a
2 ccsbBroad304_05391 pLX_304 0% 81.3% 80.2% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000480407 TCAACCCCATAATAGGGTCCACGA pLX_317 17.7% 81.3% 80.2% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV