Transcript: Human XM_017022584.1

PREDICTED: Homo sapiens thrombospondin type 1 domain containing 4 (THSD4), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
THSD4 (79875)
Length:
8092
CDS:
157..2187

Additional Resources:

NCBI RefSeq record:
XM_017022584.1
NBCI Gene record:
THSD4 (79875)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022584.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118214 CTGATGACATGACTCTAAGTA pLKO.1 1952 CDS 100% 5.625 7.875 N THSD4 n/a
2 TRCN0000118213 CCAAATGGTTTAGCACCGAAT pLKO.1 1871 CDS 100% 4.050 5.670 N THSD4 n/a
3 TRCN0000118212 CCCTGAAATCTTTCCGGTCAA pLKO.1 3039 3UTR 100% 4.050 2.835 N THSD4 n/a
4 TRCN0000118215 CTGTGTCTACAACTACTACAA pLKO.1 2100 CDS 100% 4.950 2.970 N THSD4 n/a
5 TRCN0000118216 CCTGAGATGTTCACCTCAGAA pLKO.1 862 CDS 100% 0.495 0.297 N THSD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022584.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12639 pDONR223 100% 71.6% 71.3% None (many diffs) n/a
2 ccsbBroad304_12639 pLX_304 0% 71.6% 71.3% V5 (many diffs) n/a
3 TRCN0000465313 GCCTACCTGTGCTGAACTGAAAGG pLX_317 23.8% 71.6% 71.3% V5 (many diffs) n/a
Download CSV