Transcript: Human XM_011514290.2

PREDICTED: Homo sapiens forkhead box P4 (FOXP4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FOXP4 (116113)
Length:
4084
CDS:
337..2394

Additional Resources:

NCBI RefSeq record:
XM_011514290.2
NBCI Gene record:
FOXP4 (116113)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514290.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220226 GTTCGCCTATTTCCGCAGAAA pLKO.1 1851 CDS 100% 4.950 6.930 N FOXP4 n/a
2 TRCN0000220225 CCAGTTTATCAAACACCTCAA pLKO.1 1317 CDS 100% 4.050 3.240 N FOXP4 n/a
3 TRCN0000274894 CCAGTTTATCAAACACCTCAA pLKO_005 1317 CDS 100% 4.050 3.240 N FOXP4 n/a
4 TRCN0000220228 CACCAGGATGTTCGCCTATTT pLKO.1 1842 CDS 100% 13.200 9.240 N FOXP4 n/a
5 TRCN0000274834 CACCAGGATGTTCGCCTATTT pLKO_005 1842 CDS 100% 13.200 9.240 N FOXP4 n/a
6 TRCN0000285257 TGACCCTGAATGAGATCTATA pLKO_005 1814 CDS 100% 13.200 9.240 N FOXP4 n/a
7 TRCN0000274833 GTCTCTGCAGCAGACTCATTC pLKO_005 1543 CDS 100% 10.800 7.560 N FOXP4 n/a
8 TRCN0000220227 CCAGAATCATGAGTTCTACAA pLKO.1 1716 CDS 100% 4.950 3.465 N FOXP4 n/a
9 TRCN0000274832 CCAGAATCATGAGTTCTACAA pLKO_005 1716 CDS 100% 4.950 3.465 N FOXP4 n/a
10 TRCN0000220224 CCAGGGAACAATGACAGCAAA pLKO.1 595 CDS 100% 4.950 3.465 N FOXP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514290.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09429 pDONR223 100% 98.9% 98.9% None 81C>A;651_671del n/a
2 TRCN0000467359 GCGGCTCATTGTCAACTTTCAGGT pLX_317 17.7% 96.5% 96.5% V5 (many diffs) n/a
Download CSV