Transcript: Human XM_011521190.2

PREDICTED: Homo sapiens cholinergic receptor nicotinic beta 4 subunit (CHRNB4), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHRNB4 (1143)
Length:
3628
CDS:
503..1777

Additional Resources:

NCBI RefSeq record:
XM_011521190.2
NBCI Gene record:
CHRNB4 (1143)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521190.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433016 AGATTGAGGTGAAGTACTTTC pLKO_005 741 CDS 100% 10.800 15.120 N CHRNB4 n/a
2 TRCN0000437891 CCTATGACCACACGGAGATAG pLKO_005 804 CDS 100% 10.800 7.560 N CHRNB4 n/a
3 TRCN0000061310 GCCTGACATCGTGCTTTACAA pLKO.1 616 CDS 100% 5.625 3.938 N CHRNB4 n/a
4 TRCN0000061308 CGTGACTTACGACTTCATCAT pLKO.1 943 CDS 100% 4.950 3.465 N CHRNB4 n/a
5 TRCN0000061312 GCACATGAAGAATGACGATGA pLKO.1 1588 CDS 100% 4.050 2.835 N CHRNB4 n/a
6 TRCN0000061311 CCAACTTCTATGGGAACTCCA pLKO.1 1419 CDS 100% 2.640 1.848 N CHRNB4 n/a
7 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 2382 3UTR 100% 10.800 5.400 Y MRPS16 n/a
8 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 2382 3UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521190.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00310 pDONR223 100% 85.1% 85.1% None 0_1ins222 n/a
2 ccsbBroad304_00310 pLX_304 0% 85.1% 85.1% V5 0_1ins222 n/a
3 TRCN0000475999 ACAGAAGCTTTAATAAGAGGACTT pLX_317 28.2% 85.1% 85.1% V5 0_1ins222 n/a
Download CSV