Transcript: Human XM_011527675.2

PREDICTED: Homo sapiens mitochondrial contact site and cristae organizing system subunit 13 (MICOS13), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MICOS13 (125988)
Length:
714
CDS:
294..626

Additional Resources:

NCBI RefSeq record:
XM_011527675.2
NBCI Gene record:
MICOS13 (125988)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527675.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231826 AGTTCAGCCAGTACGTGTGTC pLKO_005 520 CDS 100% 4.050 5.670 N MICOS13 n/a
2 TRCN0000231827 CCCTCCAAAGATTTACTTTCC pLKO_005 575 CDS 100% 4.050 2.835 N MICOS13 n/a
3 TRCN0000231824 GGTTCCTCATCAAGGGAAGTG pLKO_005 388 CDS 100% 4.050 2.835 N MICOS13 n/a
4 TRCN0000231825 CGTCTACCTGGTGTACGACCA pLKO_005 422 CDS 100% 0.720 0.432 N MICOS13 n/a
5 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 657 3UTR 100% 4.950 2.475 Y ERAP2 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 658 3UTR 100% 13.200 6.600 Y LIAS n/a
7 TRCN0000143567 GATCATCTGAAGTCAGGAGTT pLKO.1 696 3UTR 100% 4.050 2.025 Y GDPD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527675.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04804 pDONR223 100% 60.4% 57.8% None (many diffs) n/a
2 ccsbBroad304_04804 pLX_304 0% 60.4% 57.8% V5 (many diffs) n/a
3 TRCN0000477647 TTATAATTGTTTCACCTCCCCCGT pLX_317 100% 60.4% 57.8% V5 (many diffs) n/a
Download CSV