Transcript: Human XM_011509269.2

PREDICTED: Homo sapiens estrogen related receptor gamma (ESRRG), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ESRRG (2104)
Length:
5128
CDS:
23..1435

Additional Resources:

NCBI RefSeq record:
XM_011509269.2
NBCI Gene record:
ESRRG (2104)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033646 CGGTCTCTTTCGTTTGAGGAT pLKO.1 1004 CDS 100% 2.640 3.696 N ESRRG n/a
2 TRCN0000222439 CGAGAGTTGGTGGTTATCATT pLKO.1 878 CDS 100% 5.625 4.500 N Esrrg n/a
3 TRCN0000033645 CCTGTCAGGAAACTGTATGAT pLKO.1 323 CDS 100% 5.625 3.938 N ESRRG n/a
4 TRCN0000033647 CCTCACTACACTGTGTGACTT pLKO.1 850 CDS 100% 4.950 3.465 N ESRRG n/a
5 TRCN0000033648 CGAATGAATGTGAAATCACAA pLKO.1 537 CDS 100% 4.950 3.465 N ESRRG n/a
6 TRCN0000033644 CCCTTATTTCTTTGCTTCTTT pLKO.1 1701 3UTR 100% 5.625 3.375 N ESRRG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10808 pDONR223 100% 94% 94% None 1_84del n/a
2 ccsbBroad304_10808 pLX_304 0% 94% 94% V5 1_84del n/a
3 TRCN0000479885 GTCTCAAAGCGCGTTAGTGAGGAA pLX_317 30.6% 94% 94% V5 1_84del n/a
4 TRCN0000489295 TTTCACGAGATGAAAAACTTGAAA pLX_317 26% 93.9% 93.8% V5 1_84del;1410_1411insG n/a
5 TRCN0000488884 ACTAGTAATCTGCAACAAAAACCT pLX_317 31.1% 92.4% 92.3% V5 (not translated due to prior stop codon) 1_84del;716_736del;993G>A n/a
Download CSV