Transcript: Human XM_017027628.1

PREDICTED: Homo sapiens phosphatase and actin regulator 3 (PHACTR3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHACTR3 (116154)
Length:
4172
CDS:
13..1473

Additional Resources:

NCBI RefSeq record:
XM_017027628.1
NBCI Gene record:
PHACTR3 (116154)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027628.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052689 GCGCTGAACGACTCCATTATT pLKO.1 943 CDS 100% 15.000 21.000 N PHACTR3 n/a
2 TRCN0000417397 TGGAACACTGCCACGGAAATG pLKO_005 966 CDS 100% 10.800 15.120 N PHACTR3 n/a
3 TRCN0000425136 GACCCACTGTTGATGAATTAA pLKO_005 1250 CDS 100% 15.000 12.000 N PHACTR3 n/a
4 TRCN0000430649 CTGATACGATTCAGTGATTAC pLKO_005 1285 CDS 100% 10.800 8.640 N PHACTR3 n/a
5 TRCN0000431962 TGATACCAACACTGAACATTC pLKO_005 1510 3UTR 100% 10.800 7.560 N PHACTR3 n/a
6 TRCN0000431986 TGCAATCTTGACCACACTTAC pLKO_005 1611 3UTR 100% 10.800 7.560 N PHACTR3 n/a
7 TRCN0000052690 CCAAGCAAACAGGAACTAGAA pLKO.1 1024 CDS 100% 4.950 3.465 N PHACTR3 n/a
8 TRCN0000052692 CGCTAAGGAATCTGAGGAGAA pLKO.1 858 CDS 100% 4.050 2.835 N PHACTR3 n/a
9 TRCN0000052691 GCAGCAGATAAGGCAGCAATT pLKO.1 1369 CDS 100% 10.800 6.480 N PHACTR3 n/a
10 TRCN0000052688 GCTGTGTTTGTGAGAAGAGTA pLKO.1 1574 3UTR 100% 4.950 2.970 N PHACTR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027628.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04697 pDONR223 100% 83.3% 80.8% None (many diffs) n/a
2 ccsbBroad304_04697 pLX_304 0% 83.3% 80.8% V5 (many diffs) n/a
3 TRCN0000470159 CACGTGACTTTCCAAGATCCGTTG pLX_317 20.6% 83.3% 80.8% V5 (many diffs) n/a
Download CSV