Transcript: Human XM_017005177.1

PREDICTED: Homo sapiens interleukin 1 receptor like 2 (IL1RL2), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IL1RL2 (8808)
Length:
3287
CDS:
460..1791

Additional Resources:

NCBI RefSeq record:
XM_017005177.1
NBCI Gene record:
IL1RL2 (8808)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005177.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058858 GCCAGAGTCAATTCAGTACAT pLKO.1 1494 CDS 100% 4.950 6.930 N IL1RL2 n/a
2 TRCN0000426231 ACGATGCTGGAGAGTCAATAA pLKO_005 783 CDS 100% 13.200 9.240 N IL1RL2 n/a
3 TRCN0000058862 CGGGATGAAGGTTATTCTCAT pLKO.1 1440 CDS 100% 4.950 3.465 N IL1RL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005177.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11307 pDONR223 100% 86.7% 85.1% None (many diffs) n/a
2 ccsbBroad304_11307 pLX_304 0% 86.7% 85.1% V5 (many diffs) n/a
3 TRCN0000468698 CTCCTACTGGGCCCTCTCAGATCA pLX_317 32.4% 86.7% 85.1% V5 (many diffs) n/a
Download CSV