Transcript: Human XM_011513455.2

PREDICTED: Homo sapiens G protein-coupled receptor kinase 4 (GRK4), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRK4 (2868)
Length:
2129
CDS:
568..2007

Additional Resources:

NCBI RefSeq record:
XM_011513455.2
NBCI Gene record:
GRK4 (2868)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513455.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000988 ACCCGTAACAAAGAACACATT pLKO.1 1107 CDS 100% 4.950 3.960 N GRK4 n/a
2 TRCN0000196675 GAATACCAAGAAAGCTCATAT pLKO.1 1048 CDS 100% 13.200 9.240 N GRK4 n/a
3 TRCN0000196505 GCAAAGTAGATTCGTAGTTAG pLKO.1 1410 CDS 100% 10.800 7.560 N GRK4 n/a
4 TRCN0000000990 CTTGGCTGTCTGATCTATGAA pLKO.1 1798 CDS 100% 5.625 3.938 N GRK4 n/a
5 TRCN0000000989 GAATATGAAGTTGCCGATGAT pLKO.1 832 CDS 100% 4.950 3.465 N GRK4 n/a
6 TRCN0000000986 GCCTACGCTTATGAAACCAAA pLKO.1 1435 CDS 100% 4.950 3.465 N GRK4 n/a
7 TRCN0000197064 GCAGTCTTTGTGACAAGCAAC pLKO.1 728 CDS 100% 4.050 2.835 N GRK4 n/a
8 TRCN0000194891 CTGTCAATCTTAGATAGATTC pLKO.1 874 CDS 100% 1.080 0.756 N GRK4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513455.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06321 pDONR223 100% 68.7% 71.3% None (many diffs) n/a
2 ccsbBroad304_06321 pLX_304 0% 68.7% 71.3% V5 (many diffs) n/a
3 TRCN0000491646 ATACAACCCAACAAAGTTTTTTTC pLX_317 16.5% 68.7% 71.3% V5 (many diffs) n/a
Download CSV