Transcript: Human XM_017011844.1

PREDICTED: Homo sapiens KIAA1324 like (KIAA1324L), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIAA1324L (222223)
Length:
5520
CDS:
277..2865

Additional Resources:

NCBI RefSeq record:
XM_017011844.1
NBCI Gene record:
KIAA1324L (222223)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011844.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143564 GTGATGGGTGTACGTTCTATT pLKO.1 2354 CDS 100% 13.200 18.480 N KIAA1324L n/a
2 TRCN0000121948 CCAAGTTAGTAATGACGACTA pLKO.1 2657 CDS 100% 4.050 5.670 N KIAA1324L n/a
3 TRCN0000143638 GAGCATGACTTCCATGAGATT pLKO.1 2413 CDS 100% 4.950 3.960 N KIAA1324L n/a
4 TRCN0000145166 GCCAGTCAACAATTATTCCTT pLKO.1 2048 CDS 100% 3.000 2.400 N KIAA1324L n/a
5 TRCN0000121626 GCACTTGGCTTTGAATATAAA pLKO.1 1078 CDS 100% 15.000 10.500 N KIAA1324L n/a
6 TRCN0000144942 GCTCTCTGTACCAACAATATA pLKO.1 1957 CDS 100% 15.000 10.500 N KIAA1324L n/a
7 TRCN0000143992 CAAAGAAACCTGCTCTAGTTT pLKO.1 2898 3UTR 100% 5.625 3.938 N KIAA1324L n/a
8 TRCN0000143775 GAGTCACAGTTGAAACCACAT pLKO.1 2135 CDS 100% 4.050 2.835 N KIAA1324L n/a
9 TRCN0000127440 CCTGCTTCAATGTTGGGAATT pLKO.1 1133 CDS 100% 0.000 0.000 N 9330182L06Rik n/a
10 TRCN0000144486 CAAACATACTCTACTGGAGAA pLKO.1 536 CDS 100% 4.050 2.430 N KIAA1324L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011844.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13433 pDONR223 100% 93.1% 93.1% None 1_177del n/a
2 ccsbBroad304_13433 pLX_304 0% 93.1% 93.1% V5 1_177del n/a
3 TRCN0000465430 GCGACATGGAAGAGCTAACTACAT pLX_317 14.6% 93.1% 93.1% V5 1_177del n/a
Download CSV