Transcript: Human XM_017028151.1

PREDICTED: Homo sapiens Ras association domain family member 2 (RASSF2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RASSF2 (9770)
Length:
5597
CDS:
367..1347

Additional Resources:

NCBI RefSeq record:
XM_017028151.1
NBCI Gene record:
RASSF2 (9770)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028151.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077888 GCGTGCAATGAACCTGAAATT pLKO.1 3816 3UTR 100% 13.200 18.480 N RASSF2 n/a
2 TRCN0000077645 CCAGTATATAAAGTTCGAGAT pLKO.1 1185 CDS 100% 4.050 5.670 N Rassf2 n/a
3 TRCN0000077892 GCCACCGATTACCCGCTGATT pLKO.1 1075 CDS 100% 1.650 2.310 N RASSF2 n/a
4 TRCN0000077891 TCTGAAGACCTACAACTTGTA pLKO.1 444 CDS 100% 4.950 3.960 N RASSF2 n/a
5 TRCN0000077889 GAAGACCTACAACTTGTACTA pLKO.1 447 CDS 100% 4.950 3.465 N RASSF2 n/a
6 TRCN0000116737 CCTCCCAAGTAGCTGGAATTA pLKO.1 4753 3UTR 100% 13.200 6.600 Y CLDN18 n/a
7 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 4890 3UTR 100% 1.080 0.540 Y GPR83 n/a
8 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 4890 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028151.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02239 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02239 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472024 CCTCTAGCTTAATACGCTCCCAGT pLX_317 43% 100% 100% V5 n/a
Download CSV