Transcript: Human XM_011525330.2

PREDICTED: Homo sapiens phosphatidylinositol-5-phosphate 4-kinase type 2 beta (PIP4K2B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIP4K2B (8396)
Length:
5068
CDS:
214..1068

Additional Resources:

NCBI RefSeq record:
XM_011525330.2
NBCI Gene record:
PIP4K2B (8396)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525330.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220617 CAAACGCTTCAACGAGTTTAT pLKO.1 1029 CDS 100% 13.200 18.480 N PIP4K2B n/a
2 TRCN0000381923 TCACTGTGCATCGCAAGTATG pLKO_005 443 CDS 100% 10.800 15.120 N PIP4K2B n/a
3 TRCN0000382024 GATGACTTCGTGGGTTTATTT pLKO_005 1389 3UTR 100% 15.000 12.000 N PIP4K2B n/a
4 TRCN0000338470 CTCACGCCATACGATACAAAG pLKO_005 928 CDS 100% 10.800 8.640 N PIP4K2B n/a
5 TRCN0000220614 GCCATACGATACAAAGAAGAA pLKO.1 933 CDS 100% 4.950 3.960 N PIP4K2B n/a
6 TRCN0000220616 CCTGTCATGCTAATGCCAGAT pLKO.1 20 5UTR 100% 4.050 3.240 N PIP4K2B n/a
7 TRCN0000220615 GCATCGCAAGTATGACCTCAA pLKO.1 450 CDS 100% 4.050 3.240 N PIP4K2B n/a
8 TRCN0000338409 CCAAACGCTTCAACGAGTTTA pLKO_005 1028 CDS 100% 13.200 9.240 N PIP4K2B n/a
9 TRCN0000338469 GTTAGGGAGAAGGGTGTATTT pLKO_005 1125 3UTR 100% 13.200 9.240 N PIP4K2B n/a
10 TRCN0000194676 CCCTCATGTTTAAATGGTTAT pLKO.1 1970 3UTR 100% 10.800 7.560 N PIP4K2B n/a
11 TRCN0000196947 GCAAGATCAAGGTGGACAATC pLKO.1 57 5UTR 100% 10.800 7.560 N PIP4K2B n/a
12 TRCN0000338408 GCAAGATCAAGGTGGACAATC pLKO_005 57 5UTR 100% 10.800 7.560 N PIP4K2B n/a
13 TRCN0000338471 TCCTGTTCCTGTCATGCTAAT pLKO_005 13 5UTR 100% 10.800 7.560 N PIP4K2B n/a
14 TRCN0000024921 AGCAAGATCAAGGTGGACAAT pLKO.1 56 5UTR 100% 4.950 3.465 N Pip4k2b n/a
15 TRCN0000220613 CCCTCGATCTATTTCCTTCTT pLKO.1 2040 3UTR 100% 4.950 3.465 N PIP4K2B n/a
16 TRCN0000197129 GAAACCTACATGGTGGTTACC pLKO.1 400 CDS 100% 4.050 2.835 N PIP4K2B n/a
17 TRCN0000199907 GCCAAGGACTTGCCAACATTC pLKO.1 511 CDS 100% 10.800 6.480 N PIP4K2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525330.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11270 pDONR223 100% 26.5% 25% None (many diffs) n/a
2 ccsbBroad304_11270 pLX_304 0% 26.5% 25% V5 (many diffs) n/a
3 TRCN0000468674 TAGTGCATGCTGACGATATCGAAC pLX_317 49.5% 26.5% 25% V5 (many diffs) n/a
Download CSV