Transcript: Human XM_011528249.2

PREDICTED: Homo sapiens tyrosine kinase 2 (TYK2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TYK2 (7297)
Length:
2706
CDS:
163..2400

Additional Resources:

NCBI RefSeq record:
XM_011528249.2
NBCI Gene record:
TYK2 (7297)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528249.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381979 GCACAAGGACCAACGTGTATG pLKO_005 629 CDS 100% 10.800 15.120 N TYK2 n/a
2 TRCN0000320620 GAGTGCCTGAAGGAGTATAAG pLKO_005 2047 CDS 100% 13.200 9.240 N TYK2 n/a
3 TRCN0000003124 CGAGCACATCATCAAGTACAA pLKO.1 1704 CDS 100% 4.950 3.465 N TYK2 n/a
4 TRCN0000320550 CGAGCACATCATCAAGTACAA pLKO_005 1704 CDS 100% 4.950 3.465 N TYK2 n/a
5 TRCN0000003123 CGTGAGCCTAACCATGATCTT pLKO.1 2573 3UTR 100% 4.950 3.465 N TYK2 n/a
6 TRCN0000350264 CGTGAGCCTAACCATGATCTT pLKO_005 2573 3UTR 100% 4.950 3.465 N TYK2 n/a
7 TRCN0000003122 GAGGCCATCATTCCGCACCAT pLKO.1 1401 CDS 100% 0.880 0.616 N TYK2 n/a
8 TRCN0000199470 GATGTCAGCCTCACCCACACC pLKO.1 2494 3UTR 100% 0.000 0.000 N TYK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528249.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14870 pDONR223 0% 62.4% 61.7% None (many diffs) n/a
2 ccsbBroad304_14870 pLX_304 0% 62.4% 61.7% V5 (many diffs) n/a
3 TRCN0000467940 CCGGCTTCGTTCCCAGATGCAGTG pLX_317 8.6% 62.4% 61.7% V5 (many diffs) n/a
4 TRCN0000487907 CGCGCTCTGGAGTCTCGCTTGACA pLX_317 8.8% 62.4% 61.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV