Transcript: Human XM_006717508.2

PREDICTED: Homo sapiens MINDY lysine 48 deubiquitinase 3 (MINDY3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MINDY3 (80013)
Length:
2291
CDS:
212..1468

Additional Resources:

NCBI RefSeq record:
XM_006717508.2
NBCI Gene record:
MINDY3 (80013)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717508.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310273 TGAATGATTCCGGCTTGTAAT pLKO_005 1854 3UTR 100% 13.200 18.480 N MINDY3 n/a
2 TRCN0000264565 GAGCGATTTCATGCATTAATT pLKO_005 650 CDS 100% 15.000 10.500 N Mindy3 n/a
3 TRCN0000056108 CCCTTGATAGATCCTGTATAT pLKO.1 830 CDS 100% 13.200 9.240 N MINDY3 n/a
4 TRCN0000289714 CCCTTGATAGATCCTGTATAT pLKO_005 830 CDS 100% 13.200 9.240 N MINDY3 n/a
5 TRCN0000056112 CTGAGGAAACTGCTAGTATTT pLKO.1 558 CDS 100% 13.200 9.240 N MINDY3 n/a
6 TRCN0000307133 CTGAGGAAACTGCTAGTATTT pLKO_005 558 CDS 100% 13.200 9.240 N MINDY3 n/a
7 TRCN0000056111 CAATGGATTGAAGCAGTCAAA pLKO.1 1285 CDS 100% 4.950 3.465 N MINDY3 n/a
8 TRCN0000056110 GTTCAGAAGTTTACCAGAATT pLKO.1 682 CDS 100% 0.000 0.000 N MINDY3 n/a
9 TRCN0000289715 GTTCAGAAGTTTACCAGAATT pLKO_005 682 CDS 100% 0.000 0.000 N MINDY3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717508.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04165 pDONR223 100% 93.9% 93.9% None 798_799ins81 n/a
2 ccsbBroad304_04165 pLX_304 0% 93.9% 93.9% V5 798_799ins81 n/a
3 ccsbBroadEn_12660 pDONR223 100% 32.4% 32.2% None 286A>G;409_1254del n/a
4 ccsbBroad304_12660 pLX_304 0% 32.4% 32.2% V5 286A>G;409_1254del n/a
5 TRCN0000479216 CAGTGCTACCGAGAATATCCGGTA pLX_317 100% 32.4% 32.2% V5 286A>G;409_1254del n/a
Download CSV