Transcript: Human XR_922650.2

PREDICTED: Homo sapiens SEC22 homolog B4, pseudogene (SEC22B4P), misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEC22B4P (102724364)
Length:
7236
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_922650.2
NBCI Gene record:
SEC22B4P (102724364)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_922650.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240493 ACTTGCAGCAGTAGCTGTATT pLKO_005 888 3UTR 100% 13.200 6.600 Y SEC22B n/a
2 TRCN0000240494 TAGAACCCAGTAGGTGTATAT pLKO_005 985 3UTR 100% 13.200 6.600 Y SEC22B n/a
3 TRCN0000240495 TGGATTCAAAGGCTAACAATT pLKO_005 800 3UTR 100% 13.200 6.600 Y SEC22B n/a
4 TRCN0000379884 TGGATTCAAAGGCTAACAATT pLKO_005 800 3UTR 100% 13.200 6.600 Y Sec22b n/a
5 TRCN0000159152 GCCATCAATGAGATTTAACTT pLKO.1 1279 3UTR 100% 5.625 2.813 Y SEC22B n/a
6 TRCN0000158494 CCAGGTTATAATTACAGCTTT pLKO.1 1784 3UTR 100% 4.950 2.475 Y SEC22B n/a
7 TRCN0000162016 GAAGTGTTACAACGAGGAGAA pLKO.1 766 3UTR 100% 4.050 2.025 Y SEC22B n/a
8 TRCN0000159028 GTTAATAGTGTATGTCCGATT pLKO.1 918 3UTR 100% 4.050 2.025 Y SEC22B n/a
9 TRCN0000164424 CCTTCCCTAAGAAGTTGGCTT pLKO.1 536 3UTR 100% 2.640 1.320 Y SEC22B n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6549 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000115088 GCTAACAATTTGTCCAGTCTA pLKO.1 811 3UTR 100% 4.950 2.475 Y Sec22b n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6549 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_922650.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07444 pDONR223 100% 7.9% None (many diffs) n/a
2 ccsbBroad304_07444 pLX_304 0% 7.9% V5 (many diffs) n/a
3 TRCN0000474472 AAACTGTGATTACTCGCAATGAAC pLX_317 53.9% 7.9% V5 (many diffs) n/a
4 ccsbBroadEn_13781 pDONR223 100% 3.1% None (many diffs) n/a
5 ccsbBroad304_13781 pLX_304 0% 3.1% V5 (many diffs) n/a
6 TRCN0000469746 TCCCTGCGCCGTCCGGGTTTTCGA pLX_317 100% 3.1% V5 (many diffs) n/a
Download CSV