Transcript: Human XM_017028284.1

PREDICTED: Homo sapiens dual specificity tyrosine phosphorylation regulated kinase 1A (DYRK1A), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DYRK1A (1859)
Length:
5045
CDS:
134..2398

Additional Resources:

NCBI RefSeq record:
XM_017028284.1
NBCI Gene record:
DYRK1A (1859)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028284.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273284 GTTCGGCTTGCACCGTCATTT pLKO_005 176 CDS 100% 13.200 18.480 N DYRK1A n/a
2 TRCN0000022999 GCTGACTACTTGAAGTTCAAA pLKO.1 1445 CDS 100% 5.625 7.875 N Dyrk1a n/a
3 TRCN0000199464 GCACAGATAGAAGTGCGACTT pLKO.1 704 CDS 100% 4.050 5.670 N DYRK1A n/a
4 TRCN0000273347 GCACAGATAGAAGTGCGACTT pLKO_005 704 CDS 100% 4.050 5.670 N DYRK1A n/a
5 TRCN0000000523 CCAGCAGTTGATTCTTGTATT pLKO.1 3978 3UTR 100% 13.200 10.560 N DYRK1A n/a
6 TRCN0000321650 ATGGAGCTATGGACGTTAATT pLKO_005 2190 CDS 100% 15.000 10.500 N Dyrk1a n/a
7 TRCN0000273286 ATGTGGTCCCTCGGGTGTATT pLKO_005 1136 CDS 100% 13.200 9.240 N DYRK1A n/a
8 TRCN0000199188 CCTCTGCCGATAACCTGTTTA pLKO.1 4306 3UTR 100% 13.200 9.240 N DYRK1A n/a
9 TRCN0000273349 CCTCTGCCGATAACCTGTTTA pLKO_005 4306 3UTR 100% 13.200 9.240 N DYRK1A n/a
10 TRCN0000321714 TTGGTCATTTGCCAACTAATT pLKO_005 2720 3UTR 100% 13.200 9.240 N Dyrk1a n/a
11 TRCN0000197202 GAATGGAGCTATGGACGTTAA pLKO.1 2188 CDS 100% 10.800 7.560 N DYRK1A n/a
12 TRCN0000196506 GCTAAATTTGTGTTCCCATTT pLKO.1 4172 3UTR 100% 10.800 7.560 N DYRK1A n/a
13 TRCN0000010615 GATTCAGCAACCTCTAACTAA pLKO.1 316 CDS 100% 5.625 3.938 N DYRK1A n/a
14 TRCN0000000527 CTTTGGACAGAATGGAGCTAT pLKO.1 2179 CDS 100% 4.950 3.465 N DYRK1A n/a
15 TRCN0000000524 GCTGCTAATACCTTGGACTTT pLKO.1 2162 CDS 100% 4.950 3.465 N DYRK1A n/a
16 TRCN0000010611 GCTGCTAATACCTTGGACTTT pLKO.1 2162 CDS 100% 4.950 3.465 N DYRK1A n/a
17 TRCN0000000525 CAGTATATTCAGAGTCGCTTT pLKO.1 1064 CDS 100% 4.050 2.835 N DYRK1A n/a
18 TRCN0000010612 CAGTATATTCAGAGTCGCTTT pLKO.1 1064 CDS 100% 4.050 2.835 N DYRK1A n/a
19 TRCN0000199259 CCCATTCACATCAGTACAGTG pLKO.1 237 CDS 100% 4.050 2.835 N DYRK1A n/a
20 TRCN0000000526 CGGAAGGTTTACAATGATGGT pLKO.1 503 CDS 100% 2.640 1.848 N DYRK1A n/a
21 TRCN0000010613 CGGAAGGTTTACAATGATGGT pLKO.1 503 CDS 100% 2.640 1.848 N DYRK1A n/a
22 TRCN0000273350 CGGAAGGTTTACAATGATGGT pLKO_005 503 CDS 100% 2.640 1.848 N DYRK1A n/a
23 TRCN0000010614 CAGGTTGTAAAGGCATATGAT pLKO.1 620 CDS 100% 0.000 0.000 N DYRK1A n/a
24 TRCN0000023001 CCTGCACATTACATGACTGAA pLKO.1 2288 CDS 100% 4.950 2.970 N Dyrk1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028284.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14621 pDONR223 66.3% 98.1% 33.2% None (many diffs) n/a
Download CSV