Transcript: Human XM_017018191.1

PREDICTED: Homo sapiens syntaxin 3 (STX3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STX3 (6809)
Length:
952
CDS:
16..861

Additional Resources:

NCBI RefSeq record:
XM_017018191.1
NBCI Gene record:
STX3 (6809)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018191.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065015 GCAGCTCGAAATTACTGGCAA pLKO.1 444 CDS 100% 2.640 3.696 N STX3 n/a
2 TRCN0000065013 GCCCGGAAGAAATTGATAATT pLKO.1 769 CDS 100% 15.000 10.500 N STX3 n/a
3 TRCN0000310355 GCCCGGAAGAAATTGATAATT pLKO_005 769 CDS 100% 15.000 10.500 N STX3 n/a
4 TRCN0000303419 AGAGCATGGAGAAGCATATTG pLKO_005 278 CDS 100% 13.200 9.240 N STX3 n/a
5 TRCN0000065014 GCAGCTCACGACTGAGATTAA pLKO.1 225 CDS 100% 13.200 9.240 N STX3 n/a
6 TRCN0000299058 GCAGCTCACGACTGAGATTAA pLKO_005 225 CDS 100% 13.200 9.240 N STX3 n/a
7 TRCN0000382342 TTTCCGTTGGGCTGAATTAAG pLKO_005 842 CDS 100% 13.200 9.240 N STX3 n/a
8 TRCN0000379420 CAGACCTTCGGATTCGGAAAT pLKO_005 323 CDS 100% 10.800 7.560 N STX3 n/a
9 TRCN0000065016 GATTGAGGAAACTCGGCTTAA pLKO.1 105 CDS 100% 10.800 7.560 N STX3 n/a
10 TRCN0000310352 GATTGAGGAAACTCGGCTTAA pLKO_005 105 CDS 100% 10.800 7.560 N STX3 n/a
11 TRCN0000340167 TCTTCACTTCTGGGATCATTG pLKO_005 518 CDS 100% 10.800 7.560 N Stx3 n/a
12 TRCN0000340239 GATCATGATCTGCTGTATTAT pLKO_005 903 3UTR 100% 15.000 9.000 N Stx3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018191.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01616 pDONR223 100% 97% 96.5% None 1_1delAins22;5T>A;6_7insGCC n/a
2 ccsbBroad304_01616 pLX_304 0% 97% 96.5% V5 1_1delAins22;5T>A;6_7insGCC n/a
3 TRCN0000474779 AGGTACGACCTCGACTATGCATTC pLX_317 11.4% 97% 96.5% V5 1_1delAins22;5T>A;6_7insGCC n/a
Download CSV