Transcript: Mouse XM_006497054.3

PREDICTED: Mus musculus vang-like 2 (van gogh, Drosophila) (Vangl2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vangl2 (93840)
Length:
2823
CDS:
1019..2584

Additional Resources:

NCBI RefSeq record:
XM_006497054.3
NBCI Gene record:
Vangl2 (93840)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497054.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124571 GTTTCTCTAGTGGATGCTTTA pLKO.1 1676 CDS 100% 10.800 7.560 N Vangl2 n/a
2 TRCN0000180622 GTGTGGATCCTGGAGAAGTAT pLKO.1 1835 CDS 100% 5.625 3.938 N VANGL2 n/a
3 TRCN0000124570 CGTTTCTCTAGTGGATGCTTT pLKO.1 1675 CDS 100% 4.950 3.465 N Vangl2 n/a
4 TRCN0000124572 GTTCTGCATTACCCACGACAT pLKO.1 2293 CDS 100% 4.050 2.835 N Vangl2 n/a
5 TRCN0000124569 GACACATTTCTGCCAGTCCTA pLKO.1 2657 3UTR 100% 2.640 1.848 N Vangl2 n/a
6 TRCN0000124573 TGGAGATAAATCAGTGACGAT pLKO.1 1135 CDS 100% 2.640 1.848 N Vangl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497054.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08718 pDONR223 100% 89.9% 99.4% None (many diffs) n/a
2 ccsbBroad304_08718 pLX_304 0% 89.9% 99.4% V5 (many diffs) n/a
3 TRCN0000471123 AGATCCATGTCGATGCTCTGGCTT pLX_317 22.5% 89.9% 99.4% V5 (many diffs) n/a
Download CSV