Transcript: Mouse XM_006526340.3

PREDICTED: Mus musculus janus kinase and microtubule interacting protein 2 (Jakmip2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Jakmip2 (76217)
Length:
8344
CDS:
797..2665

Additional Resources:

NCBI RefSeq record:
XM_006526340.3
NBCI Gene record:
Jakmip2 (76217)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526340.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000347419 GCCAAGACTATGTGCTTTAAA pLKO_005 2696 3UTR 100% 15.000 10.500 N Jakmip2 n/a
2 TRCN0000347350 GGCTCTTGACCAGGCATATAT pLKO_005 2290 CDS 100% 15.000 10.500 N Jakmip2 n/a
3 TRCN0000347420 AGAATCTGAGCTACGATTTAG pLKO_005 1585 CDS 100% 13.200 9.240 N Jakmip2 n/a
4 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6473 3UTR 100% 4.950 2.475 Y KAAG1 n/a
5 TRCN0000165205 GCCTCAGTTTCCTCATCTGTA pLKO.1 4195 3UTR 100% 4.950 2.475 Y YIF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526340.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02255 pDONR223 100% 64.9% 71.4% None (many diffs) n/a
2 ccsbBroad304_02255 pLX_304 0% 64.9% 71.4% V5 (many diffs) n/a
3 TRCN0000481259 TGGACTTACAACCAGCCCTACCCT pLX_317 17.5% 64.9% 71.4% V5 (many diffs) n/a
Download CSV