Transcript: Mouse XR_376343.3

PREDICTED: Mus musculus BEN domain containing 5 (Bend5), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bend5 (67621)
Length:
2889
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_376343.3
NBCI Gene record:
Bend5 (67621)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_376343.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216111 CATCGTCAGAGAGTGTTTATA pLKO.1 2330 3UTR 100% 15.000 10.500 N Bend5 n/a
2 TRCN0000176296 CCCAAACTTTCTCTCAGTCAT pLKO.1 1658 3UTR 100% 4.950 3.465 N Bend5 n/a
3 TRCN0000173161 CGAAACTACCAGCAGCAACAA pLKO.1 1943 3UTR 100% 4.950 3.465 N Bend5 n/a
4 TRCN0000193952 GAACAGTGTGATGCAGAAGAA pLKO.1 1627 3UTR 100% 4.950 3.465 N Bend5 n/a
5 TRCN0000175431 CTACAAGTTACCCAAGGAGAT pLKO.1 2175 3UTR 100% 4.050 2.835 N Bend5 n/a
6 TRCN0000129441 GCATCGTCAGAGAGTGTTTGT pLKO.1 2329 3UTR 100% 4.950 3.465 N BEND5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_376343.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08942 pDONR223 100% 34.3% None (many diffs) n/a
2 ccsbBroad304_08942 pLX_304 0% 34.3% V5 (many diffs) n/a
3 TRCN0000470324 CTAGTTCACTCCTCAGTACGAGAT pLX_317 28.7% 34.3% V5 (many diffs) n/a
4 ccsbBroadEn_14265 pDONR223 100% 18.7% None (many diffs) n/a
5 ccsbBroad304_14265 pLX_304 0% 18.7% V5 (many diffs) n/a
6 TRCN0000467530 TAATTGTAGAAGAGTACATATTTA pLX_317 54.1% 18.7% V5 (many diffs) n/a
Download CSV