Transcript: Mouse XM_006499946.2

PREDICTED: Mus musculus negative elongation factor complex member C/D, Th1l (Nelfcd), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nelfcd (57314)
Length:
2313
CDS:
274..1875

Additional Resources:

NCBI RefSeq record:
XM_006499946.2
NBCI Gene record:
Nelfcd (57314)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499946.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276907 GAGCTCAAGTCCACGTCAAAG pLKO_005 1246 CDS 100% 10.800 15.120 N Nelfcd n/a
2 TRCN0000276854 TGGTCAGTTATATCCGCAAAT pLKO_005 1637 CDS 100% 10.800 15.120 N Nelfcd n/a
3 TRCN0000193622 CTGTAACTGAAGCCGAAACTT pLKO.1 1882 3UTR 100% 5.625 3.938 N Nelfcd n/a
4 TRCN0000323451 CTGTAACTGAAGCCGAAACTT pLKO_005 1882 3UTR 100% 5.625 3.938 N Nelfcd n/a
5 TRCN0000173721 CTGTGCTGCAACGAGAACAAA pLKO.1 1288 CDS 100% 5.625 3.938 N Nelfcd n/a
6 TRCN0000350226 CTGTGCTGCAACGAGAACAAA pLKO_005 1288 CDS 100% 5.625 3.938 N Nelfcd n/a
7 TRCN0000174452 CTGAGTTTGCAAAGATGGTAT pLKO.1 776 CDS 100% 4.950 3.465 N Nelfcd n/a
8 TRCN0000173659 CGCTACTTTGTCACTGAGGTT pLKO.1 1693 CDS 100% 2.640 1.848 N Nelfcd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499946.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08299 pDONR223 100% 79.4% 89.1% None (many diffs) n/a
2 ccsbBroad304_08299 pLX_304 0% 79.4% 89.1% V5 (many diffs) n/a
3 TRCN0000480128 CTCCCACGCCAATAATTAACGCAG pLX_317 21% 79.4% 89.1% V5 (many diffs) n/a
Download CSV